/usr/bin/ssake is in ssake 4.0-1.
This file is owned by root:root, with mode 0o755.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800 1801 1802 1803 1804 1805 1806 1807 1808 1809 1810 1811 1812 1813 1814 1815 1816 1817 1818 1819 1820 1821 1822 1823 1824 1825 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837 1838 1839 1840 1841 1842 1843 1844 1845 1846 1847 1848 1849 1850 1851 1852 1853 1854 1855 1856 1857 1858 1859 1860 1861 1862 1863 1864 1865 1866 1867 1868 1869 1870 1871 1872 1873 1874 1875 1876 1877 1878 1879 1880 1881 1882 1883 1884 1885 1886 1887 1888 1889 1890 1891 1892 1893 1894 1895 1896 1897 1898 1899 1900 1901 1902 1903 1904 1905 1906 1907 1908 1909 1910 1911 1912 1913 1914 1915 1916 1917 1918 1919 1920 1921 1922 1923 1924 1925 1926 1927 1928 1929 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941 1942 1943 1944 1945 1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 2030 2031 2032 2033 2034 2035 2036 2037 2038 2039 2040 2041 2042 2043 2044 2045 2046 2047 2048 2049 2050 2051 2052 2053 2054 2055 2056 2057 | #!/usr/bin/perl
#AUTHOR
# Rene Warren (c) 2006-2018
# Short Sequence Assembly by K-mer search and 3' Extension (SSAKE)
# rwarren at bcgsc.ca
#NAME
# SSAKE Rene Warren, Jan 2018
# v4.0+ Initial support for linked reads (reads co-located to genomic locus via barcode or other means)
# v3.8.5+ Bug fix (only affected targeted de novo assembly -s mode)
# v3.8.4+ Improvements to the TASR modules, recruiting pairs when reads have a k-mer match
# v3.8.3+ Included option to ignore reads making up the consensus base extension (-y)
# v3.8.3+ Included tie-breaker option (-q) when determining consensus from equal-coverage bases
# v3.8.2+ Included target word length (-j option) - TASR behaviour (-k option)
# v3.8+ is 30% faster than the previous release. Additional assembly control has been implemented (-w) that limits the generation of low depth of coverage contigs
# v3.7+ Improved support for seed-based -s assemblies, notably read-space restriction option -i (TASR behavior, without support for fastq files)
# v3.6+ Supports various insert size libraries. This release also has preliminary support for paired-end Sanger reads
# v3.5+ Uses mate pairs to help resolve repeats (preventing contig misassemblies) at run time and attempts to force-fill gaps with redundant sequences (improves contiguity and repeat resolution)
# v3.4.1 "N pad" gaps while merging contigs
# v3.4+ Explore possible contig merges within a scaffold
# v3.3+ Fixed bug in PET routine. Track individual sequences using -c option (only reads that fully overlap)
# v3.2.1+ is ~30% faster and requires 33% less memory compared to 15-node SSAKE3.2beta
# v3.2+ Adjust contig ends to find new extension possibilities. Important bug fix - addressed issues in failure to explore all read space (README for details)
# v3.1+ Allows users to specify a seed sequence file. This feature can be used to allow extension of existing DNA sequences using short reads
# v3.0+ Supports mate pairs for scaffolding
# v2.0+ Handles errors in reads
#SYNOPSIS
# Progressive assembly of millions of short DNA sequences by k-mer search through a prefix tree and 3' extension
#DOCUMENTATION
# SSAKE.readme distributed with this software @ www.bcgsc.ca
# Warren RL, Sutton GG, Jones SJM, Holt RA. 2007. Assembling millions of short DNA sequences using SSAKE. Bioinformatics. 23(4):500-501
# http://www.bcgsc.ca/platform/bioinfo/software/ssake
# We hope this code is useful to you -- Please send comments & suggestions to rwarren * bcgsc.ca
# If you use SSAKE, the SSAKE code or ideas, please cite our work
#LICENSE
# SSAKE Copyright (c) 2006-2018 Canada's Michael Smith Genome Science Centre. All rights reserved.
# This program is free software; you can redistribute it and/or
# modify it under the terms of the GNU General Public License
# as published by the Free Software Foundation; either version 2
# of the License, or (at your option) any later version.
# This program is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU General Public License for more details.
# note: insert/fragment size and distance between pairing reads are used interchangeably
use strict;
use Getopt::Std;
use Net::SMTP;
use vars qw($opt_f $opt_m $opt_o $opt_v $opt_r $opt_p $opt_d $opt_l $opt_a $opt_z $opt_e $opt_g $opt_s $opt_t $opt_b $opt_c $opt_x $opt_n $opt_h $opt_i $opt_w $opt_j $opt_q $opt_y $opt_u);
#k unused letters
getopts('f:m:o:v:r:p:d:l:a:z:e:g:s:t:b:c:x:n:h:u:w:j:q:y:i:');
my ($targetwordlen,$base_overlap,$min_overlap,$verbose,$MIN_READ_LENGTH,$SEQ_SLIDE,$min_base_ratio,$paired,$min_links,$max_link_ratio,$contig_size_cutoff,$insert_stdev,$unpaired_file,$seed_file,$max_trim,$base_name,$tracked,$forcetrack,$max_count_trim,$min_tig_overlap,$npad_gaps,$ignorehead,$space_restriction,$min_depth_of_coverage,$tie_breaker,$ignore_read,$independent)=(15,2,20,0,21,1,0.7,0,5,0.3,100,0.75,"no-g","no-targetSeed",0,"",0,0,10,20,0,0,0,0,0,0,1);
my $version = "[v4.0]";
my $dev = "rwarren\@bcgsc.ca";
my $per;
my $MAX = 0;
my $MAX_TOP = 1500; # this is the very maximum anchoring edge sequence that will be searched (designed for use with -s to prevent long searches)
my $TRACK_COUNT = 0;
my $LR_MAXDIST_APART = 60000;
my $illuminaLengthCutoff = 500; ### means all sequence reads greater than this are not illumina sequences
my $LOW_COVERAGE_TIG_IN_A_ROW = 100; ### SEE THIS MANY CONTIGS IN A ROW HAVING < -w COVERAGE TO TERMINATE
#-------------------------------------------------
if(! $opt_f || ! $opt_w){
print "\nUsage: $0 $version\n";
print "-f File containing all the [paired (-p 1)] reads (required)\n";
print "\t With -p 1:\n";
print "\t! Target insert size must be indicated at the end of the header line (e.g. :400 for a 400bp fragment/insert size)\n";
print "\t! Paired reads must be separated by \":\"\n";
print "\t >header:400 (or >header_barcode:400)\n\t ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:GCGCACGACGCAGCACAGCAGCAGACGAC\n";
print "-g Fasta file containing unpaired sequence reads (optional)\n";
print "-w Minimum depth of coverage allowed for contigs (e.g. -w 1 = process all reads [v3.7 behavior], required, recommended -w 5)\n";
print " *The assembly will stop when 50+ contigs with coverage < -w have been seen.*\n";
print "-s Fasta file containing sequences to use as seeds exclusively (specify only if different from read set, optional)\n";
print "\t-i Independent (de novo) assembly i.e Targets used to recruit reads for de novo assembly, not guide/seed reference-based assemblies (-i 1 = yes (default), 0 = no, optional)\n";
print "\t-j Target sequence word size to hash (default -j $targetwordlen)\n";
print "\t-u Apply read space restriction to seeds while -s option in use (-u 1 = yes, default = no, optional)\n";
print "-m Minimum number of overlapping bases with the seed/contig during overhang consensus build up (default -m $min_overlap)\n";
print "-o Minimum number of reads needed to call a base during an extension (default -o $base_overlap)\n";
print "-r Minimum base ratio used to accept a overhang consensus base (default -r $min_base_ratio)\n";
print "-t Trim up to -t base(s) on the contig end when all possibilities have been exhausted for an extension (default -t $max_trim, optional)\n";
print "-c Track base coverage and read position for each contig (default -c $tracked, optional)\n";
print "-y Ignore read mapping to consensus (-y 1 = yes, default = no, optional)\n";
print "-h Ignore read name/header *will use less RAM if set to -h 1* (-h 1 = yes, default = no, optional)\n";
print "-b Base name for your output files (optional)\n";
print "-z Minimum contig size to track base coverage and read position (default -z $contig_size_cutoff, optional)\n";
print "-q Break tie when no consensus base at position, pick random base (-q 1 = yes, default = no, optional)\n";
print "-p Paired-end reads used? (-p 1 = yes, default = no, optional)\n";
print "-v Runs in verbose mode (-v 1 = yes, default = no, optional)\n";
print "============ scaffolding options below only considered with -p 1 ============\n";
print "-e Error (%) allowed on mean distance e.g. -e 0.75 == distance +/- 75% (default -e $insert_stdev, optional)\n";
print "-l Minimum number of links (read pairs) to compute scaffold (default -k $min_links, optional)\n";
print "-a Maximum link ratio between two best contig pairs *higher values lead to least accurate scaffolding* (default -a $max_link_ratio, optional)\n";
#print "-x Minimum overlap required between contigs to merge adjacent contigs in a scaffold (default -x $min_tig_overlap, optional)\n";
#print "-n N-pad gaps (-n 1 = yes, default = no $npad_gaps, optional)\n";
die "\nError: Missing mandatory options -f and -w.\n\n";
}
my $file = $opt_f;
$min_overlap = $opt_m if($opt_m);
$base_overlap = $opt_o if($opt_o);
$min_base_ratio = $opt_r if($opt_r);
$max_trim = $opt_t if($opt_t);
$verbose = $opt_v if($opt_v);
$paired = $opt_p if($opt_p);
$min_links = $opt_l if($opt_l);
$max_link_ratio = $opt_a if($opt_a);
$contig_size_cutoff = $opt_z if($opt_z);
$insert_stdev = $opt_e if($opt_e);
$unpaired_file = $opt_g if($opt_g);
$seed_file = $opt_s if($opt_s);
$base_name = $opt_b if($opt_b);
$tracked = $opt_c if($opt_c);
$min_tig_overlap = $opt_x if($opt_x);
$npad_gaps = $opt_n if($opt_n);
$ignorehead = $opt_h if($opt_h);
$targetwordlen = $opt_j if($opt_j);
$tie_breaker = $opt_q if($opt_q);
$ignore_read = $opt_y if($opt_y);
$min_depth_of_coverage = $opt_w if($opt_w); #### Lower bound on contig coverage
my $assemblyruninfo="";
if($paired || $tracked){ $forcetrack = 1; }
my $display_unpaired_file = $1 if ($unpaired_file=~/([^\/]*)$/);
my $display_seed_file = $1 if ($seed_file=~/([^\/]*)$/);
#-------------------------------------------------
if(! -e $file){
die "Invalid file: $file -- fatal\n";
}
if($opt_s && ! -e $opt_s){### seed file specified, but does not exist
die "The file $opt_s you specified does not exist -- fatal\n";
}elsif($opt_s && -e $opt_s){### seed file specified and exists
$space_restriction = $opt_u if($opt_u);
$independent = $opt_i;
if($independent >= 1 || $independent < 0 || $independent eq ""){
$independent = 1;
$space_restriction = 1;###restrict the space to that of the target when doing targeted de novo assembly -i mode
}
}
### Naming output files
if ($base_name eq ""){
$base_name = $file . ".ssake_m" . $min_overlap . "_o" . $base_overlap . "_r" . $min_base_ratio . "_t" . $max_trim . "_w" . $min_depth_of_coverage . "_q" . $tie_breaker . "_y" . $ignore_read;
if($paired){
$base_name .= "_e" . $insert_stdev . "_l" . $min_links . "_a" . $max_link_ratio . "_z" . $contig_size_cutoff . "_g-" . $display_unpaired_file;
}
if($opt_s){
$base_name .= "_s-" . $display_seed_file . "_i" . $independent . "_j-" . $targetwordlen . "_u-" . $space_restriction;
}
my $pid_num = getpgrp(0);
$base_name .= "_pid" . $pid_num;
}
my $contig = $base_name . "_contigs.fa";
my $singlet = $base_name . "_singlets.fa";
my $short = $base_name . "_short.txt";
my $log = $base_name . ".log";
my $scaffold = $base_name . ".scaffolds" if ($paired);
my $scaffold_fasta = $base_name . "_scaffolds.fa" if ($paired);
my $mergedtigs = $base_name . "_mergedcontigs.fa" if ($paired);#deprecated Jan 2018
my $issues = $base_name . "_pairing-issues.txt" if ($paired);
my $distribution = $base_name . "_pairing-distribution.csv" if ($paired);
my $covfile = $base_name . "_coverage.csv" if ($tracked);
my $rdpositionfile = $base_name . ".readposition" if ($tracked);
my $pileupfile = $base_name . ".pileup" if ($space_restriction);
open (LOG, ">$log") || die "Can't write to $log -- fatal\n";
if($min_overlap < 16 || $min_overlap > 100){
my $outofbound_message = "-m must be a number between 16-100 ...Exiting.\n";
print $outofbound_message;
print LOG $outofbound_message;
close LOG;
exit;
}
if($base_overlap < 1){
my $outofbound_message = "-o must be set to 1 or higher ...Exiting.\n";
print $outofbound_message;
print LOG $outofbound_message;
close LOG;
exit;
}
if($min_base_ratio <= 0.5 || $min_base_ratio > 1){
my $outofbound_message = "-r must be a number between 0.51 and 1.00 ...Exiting.\n";
print $outofbound_message;
print LOG $outofbound_message;
close LOG;
exit;
}
#-------------------------------------------------
my $init_message = "\nRunning: $0 $version\n-f $file\n-s $seed_file\n\t-i $independent\n\t-j $targetwordlen\n\t-u $space_restriction\n-h $ignorehead\n-w $min_depth_of_coverage\n-m $min_overlap\n-o $base_overlap\n-r $min_base_ratio\n-t $max_trim\n-q $tie_breaker\n-y $ignore_read\n";
if($tracked){$init_message .= "-c $tracked\nCoverage: $covfile\nRead position: $rdpositionfile\n";$init_message .= "Pileup: $pileupfile\n" if(! $independent && $space_restriction);}
if($forcetrack){$init_message .= "-z $contig_size_cutoff\n";}
if($paired){$init_message .= "-p $paired\n-e $insert_stdev\n-l $min_links\n-a $max_link_ratio\nUnpaired reads (optional) -g $unpaired_file\nScaffold layout: $scaffold\nPairing issues: $issues\nPairing distance distribution: $distribution\n";}
$init_message .= "\nSinglets: $singlet\nContigs: $contig\n";
if($paired){$init_message .= "Scaffolds: $scaffold_fasta\n";}
$init_message .= "\nExcluded reads: $short\nLog: $log\n";
print $init_message;
print LOG $init_message;
$assemblyruninfo=$init_message . "\n";
#-------------------------------------------------
my $date = `date`;
chomp($date);
my $reading_reads_message = "\n=>Reading sequences initiated $date\n";
print $reading_reads_message;
print LOG $reading_reads_message;
$assemblyruninfo.=$reading_reads_message;
my $encoded = &encodeBases();
my ($seed,$seedsplit);
#-------------------------------------------------
### Allow user to specify a fasta file containing sequences to use as seeds, exclusively
if(-e $opt_s){
my $use_seed_message = "Using seed sequence file $opt_s for this assembly.\nNote: ONLY sequences in $opt_s will be used as seeds (i.e. -f $opt_f and -g $opt_g will NOT be used as seeds, only used for extension)\n";
print LOG $use_seed_message;
print $use_seed_message if ($verbose);
($seed,$seedsplit) = &loadSeed($opt_s,$targetwordlen);
}
my($set,$bin,$matepair);
my($sumall,$ctall)=(0,0);
($set,$bin,$matepair,$sumall,$ctall) = &readFasta($matepair,$set,$bin,$file,$short,$paired,$encoded,$seedsplit,$space_restriction,$targetwordlen,$ignorehead,$sumall,$ctall);
($set,$bin,$matepair,$sumall,$ctall) = &readFasta($matepair,$set,$bin,$unpaired_file,$short,0,$encoded,$seedsplit,$space_restriction,$targetwordlen,$ignorehead,$sumall,$ctall) if (-e $opt_g);
my $fc = $sumall / 3000000000;
my $statslog = "Total reads interrogated (total bases): $ctall ($sumall) -- human genome equivalent(s) = %.4f\n";
printf $statslog, $fc;
printf LOG $statslog, $fc;
if(! $opt_s){
$seed = $set;
$TRACK_COUNT = 0;
}else{
if($independent){
my $ind_message = "-i has been set to 1, which means the target sequences are USED for recruiting reads for de novo assembly, NOT target-based reference guided assemblies\n";
printf $ind_message;
print LOG $ind_message;
$seed = {};
$seed = $set;
}else{
my $ind_message = "-i has been set to 0, which means the target sequences are USED for recruiting reads for target-based reference guided assemblies (only de novo extension on the ends\n";
printf $ind_message;
print LOG $ind_message;
}
}
my $seed_number_message = "Number of unique seed sequences: " . keys( %$seed ) . "\n";
printf $seed_number_message;
print LOG $seed_number_message;
#-------------------------------------------------
$date = `date`;
chomp($date);
my $ssake_start_message = "\n=>Sequence assembly initiated $date\n";
print $ssake_start_message;
print LOG $ssake_start_message;
$assemblyruninfo.=$ssake_start_message . "\n$seed_number_message\n";
#-------------------------------------------------
my ($sgl_count,$tig_count,$previous_index) = (1,1,0);
open (TIG, ">$contig") || die "Can't write to $contig -- fatal\n";
open (SIN, ">$singlet") || die "Can't write to $singlet -- fatal\n";
if ($paired){open (SC, ">$scaffold") || die "Can't write to $scaffold -- fatal\n";}
if($tracked){open (CF, ">$covfile") || die "Can't write to $covfile -- fatal\n";}
if($tracked){open (RP, ">$rdpositionfile") || die "Can't write to $rdpositionfile -- fatal\n";}
if(! $independent && $space_restriction){open (PU, ">$pileupfile") || die "Can't write to $pileupfile -- fatal\n";}
my ($tig_length,$track_all,$alternate);
eval{
my $status_bar = "+";
for(my $i=1;$i<=99;$i++){
$per->{$i}++;
my $ct = $i /10;
if($ct == int($ct)){$status_bar .= $ct;}else{$status_bar .= "-";}
}
$status_bar .= "+ x 10 [% complete]";
print "$status_bar\n.";
my $keys_start = keys ( %$seed );
my $low_total = 0;
my $prev_cov = 0;
#--------------------------------------------
ASSEMBLY:
foreach my $seq (keys %$seed){#cycle through the input [normalized] reads
#foreach my $seq (sort {$seed->{$a}{'count'}<=>$seed->{$b}{'count'}} keys %$seed){#cycle through the input [normalized] reads
#foreach my $seq (sort {$seed->{$b}{'count'}<=>$seed->{$a}{'count'}} keys %$seed){#cycle through the input [normalized] reads
my $track;
my ($pu_seed_name,$pu_seed_ori)=("","");
if(! $independent && $space_restriction){
$pu_seed_name = $seed->{$seq}{'seed_name'};
$pu_seed_ori = $seed->{$seq}{'ori'};
}
if(defined $seed->{$seq}){#sequence read hasn't been used, is longer than 16 nt and the user-defined overlap minimum -m
my $seed_name = "";
if(defined $seed->{$seq}{'seed_name'}){$seed_name = "|seed:" . $seed->{$seq}{'seed_name'};}
my $orig_mer = length($seq);
if($forcetrack){
$track->{$seq}{'start'} = 1;
$track->{$seq}{'end'} = $orig_mer;
$track->{$seq}{'cov'} = $seed->{$seq}{'count'};
$track->{$seq}{'names'} = $seed->{$seq}{'names'};
}
#### Delete keys ref
my $start_sequence = $seq;
my $reads_needed = $seed->{$seq}{'count'}; #tracks coverage
my $total_bases = $orig_mer * $reads_needed;
($bin,$set,$seed) = deleteData($bin,$set,$seed,$seq,$encoded); #remove k-mer from hash table and prefix tree
print "\n\n>>> START SEED SEQUENCE :: $seq <<<\n\n" if ($verbose);
my $barcodeList;
($seq, $set, $bin, $reads_needed, $total_bases, $track, $barcodeList) = doExtension("3 prime", $orig_mer, $seq, $set, $bin, $reads_needed, $total_bases, $min_overlap, $base_overlap, $min_base_ratio, $verbose, $track, $forcetrack, $tig_count, $max_trim, $encoded, $matepair,$tie_breaker,$ignore_read,$barcodeList);
####end of 3' extension, beginning of 5' extension (via 3' RC)
my $seqrc = reverseComplement($seq);
($seqrc, $set, $bin, $reads_needed, $total_bases, $track, $barcodeList) = doExtension("5 prime", $orig_mer, $seqrc, $set, $bin, $reads_needed, $total_bases, $min_overlap, $base_overlap, $min_base_ratio, $verbose, $track, $forcetrack, $tig_count, $max_trim, $encoded, $matepair,$tie_breaker,$ignore_read,$barcodeList);
####end of 5' extension
my $leng = length($seqrc);
my $reversetig = reverseComplement($seqrc); ### return to sequence, as provided
my $trimmed_length = length($start_sequence) - 2*($max_trim);
if($leng > $trimmed_length || ($reads_needed > 1 && $opt_s)){ ### second conditional is similar to TASR, output contig if targeted assembly mode and more reads have been recruited.
last ASSEMBLY if ($low_total >= $LOW_COVERAGE_TIG_IN_A_ROW); ### sudden termination based on expected depth ov coverage
### commented out: && $start_sequence ne $seqrc && $start_sequence ne $reversetig
my $cov = $total_bases / $leng;
printf TIG ">contig%i|size%i|read%i|cov%.2f$seed_name\n%s\n", ($tig_count,$leng,$reads_needed,$cov,$reversetig); #print contigs to file
$tig_length->{$tig_count} = $leng;
#if($prev_cov >= $min_depth_of_coverage){ $low_total=0; }###JAN2018 NEED $LOW_COVERAGE_TIG_IN_A_ROW to TERMINATE
$low_total++ if ($cov < $min_depth_of_coverage);
if($forcetrack && $leng >= $contig_size_cutoff){
if($tracked){ ### only execute & report if user specifies -c
printf CF ">contig%i|size%i|read%i|cov%.2f$seed_name\n", ($tig_count,$leng,$reads_needed,$cov);
printf RP ">contig%i|size%i|read%i|cov%.2f$seed_name\n", ($tig_count,$leng,$reads_needed,$cov);
my @tigarr=split(//,$reversetig);
my $pileup;
my $gpos=0;
if(! $independent && $space_restriction){
foreach my $gbase(@tigarr){
$gpos++;
$pileup->{$gpos}{'tig'}=$gbase;
}
}
### initialize all positions;
my $hashcov;
for (my $bpo=1;$bpo<=$leng;$bpo++){
$hashcov->{$bpo}=0;
}
foreach my $rd (sort {$track->{$a}{'start'}<=>$track->{$b}{'start'}} keys %$track){
my $rdlist = $track->{$rd}{'names'};
foreach my $rdoflist (keys %$rdlist){
printf RP "$rdoflist,$track->{$rd}{'start'},$track->{$rd}{'end'}\n" if($rdoflist ne "");
my @covposition;
if($track->{$rd}{'start'} < $track->{$rd}{'end'}){### plus strand
my ($sss,$eee) = ($track->{$rd}{'start'},$track->{$rd}{'end'});
if($sss<0){$sss=1;}###<<
if($eee>$leng){$eee=$leng;}###<<
@covposition = ($sss .. $eee);
my @rdseq=split(//,$rd);
my @rdqua=split(//,$rdlist->{$rdoflist});
my $rdpos=0;
if(! $independent && $space_restriction){
#foreach my $vpos(@covposition){
for(my $vpos=$track->{$rd}{'start'};$vpos<=$track->{$rd}{'end'};$vpos++){
if($vpos>=1 && $vpos<=$gpos){
#print "***$rdoflist***$seed->{$rd}{'seed_name'}***\n";
if($rdoflist eq $pu_seed_name){
my @seedarr = split(//,$pu_seed_ori);
$pileup->{$vpos}{'interest'} = $seedarr[$rdpos] if($seedarr[$rdpos]=~/[acgt]/);
#print "$pileup->{$vpos}{'interest'} $rdoflist eq $seed->{$rd}{'seed_name'}\n";
}
my $tmpq = $rdqua[$rdpos];
$pileup->{$vpos}{'qua'} .= "$tmpq";
#if($vpos == $track->{$rd}{'start'}){
# $pileup->{$vpos}{'seq'} .= "^";
#}elsif($vpos == $track->{$rd}{'end'}){
# $pileup->{$vpos}{'seq'} .= "\$";
#}else{
if($pileup->{$vpos}{'tig'} eq $rdseq[$rdpos]){
$pileup->{$vpos}{'seq'} .= ".";
}else{
$pileup->{$vpos}{'seq'} .= $rdseq[$rdpos];
}
#}
}
$rdpos++;
}
}
}else{### minus strand
my ($sss,$eee) = ($track->{$rd}{'end'},$track->{$rd}{'start'});
if($sss<0){$sss=1;}###<<
if($eee>$leng){$eee=$leng;}###<<
@covposition = ($sss .. $eee);
my @rdseq=split(//,reverseComplement($rd));
my @rdqua=split(//,reverse($rdlist->{$rdoflist}));
my $rdpos=0;
if(! $independent && $space_restriction){
#foreach my $vpos(@covposition){
for(my $vpos=$track->{$rd}{'end'};$vpos<=$track->{$rd}{'start'};$vpos++){
if($vpos>=1 && $vpos<=$gpos){
my $tmpq = $rdqua[$rdpos];
$pileup->{$vpos}{'qua'} .= "$tmpq";
#if($vpos == $track->{$rd}{'start'}){
# $pileup->{$vpos}{'seq'} .= "^";
#}elsif($vpos == $track->{$rd}{'end'}){
# $pileup->{$vpos}{'seq'} .= "\$";
#}else{
if($pileup->{$vpos}{'tig'} eq $rdseq[$rdpos]){
$pileup->{$vpos}{'seq'} .= ",";
}else{
$pileup->{$vpos}{'seq'} .= lc($rdseq[$rdpos]);
}
#}
}
$rdpos++;
}
}#space restriction
}#plus/minus
foreach my $pss (@covposition){$hashcov->{$pss}++;}
}
}
foreach my $pss (sort {$a<=>$b} keys %$hashcov){
$hashcov->{$pss}=$base_overlap if(! $hashcov->{$pss});
print CF "$hashcov->{$pss},";
}
print CF "\n";
if(! $independent && $space_restriction){
foreach my $tigpos (sort {$a<=>$b} keys %$pileup){
my $depth = length($pileup->{$tigpos}{'seq'});
my $base = "";
if($pileup->{$tigpos}{'interest'} ne ""){
$base = $pileup->{$tigpos}{'interest'};
}else{
$base = $pileup->{$tigpos}{'tig'};
}
print PU "contig$tig_count\t$tigpos\t$base\t$depth\t$pileup->{$tigpos}{'seq'} $pileup->{$tigpos}{'qua'}\n";
}
print PU "\n";
}
}
($track_all,$alternate) = &trackReads($track,$track_all,$alternate,$tig_count); ### all pairs from all contigs (track for scaffolding)
}
$prev_cov = $cov;
$tig_count++;
}else{
my $cov = $reads_needed;
my $singlet_leng = length($start_sequence);
printf SIN ">singlet%i|size%i|read%i|cov%.2f$seed_name\n%s\n", ($sgl_count,$singlet_leng,$reads_needed,$cov,$start_sequence); #print singlets to file
$sgl_count++;
}
}
my $keys_left = keys( %$seed );
my $index = (int((($keys_start-$keys_left)/$keys_start)*100));
if(defined $per->{$index}){
print "." x ($index - $previous_index);
$|=1; ###clear buffer
delete $per->{$index};
}
$previous_index = $index;
last ASSEMBLY if (! $keys_left);
}
print ".";
};###end eval block
$date = `date`;
chomp($date);
if($@){
my $message = $@;
my $failure = "\nSomething went wrong running $0 $date\n$message\n";
print $failure;
print LOG $failure;
$assemblyruninfo.=$failure . "\n";
}else{
my $success = "\nContig assembly executed normally $date\n";
print $success;
print LOG $success;
$assemblyruninfo.=$success . "\n";
}
close TIG;
close SIN;
close SHO;
if($tracked){
close CF;
close RP;
}
if(! $independent && $space_restriction){
close PU;
}
#------------------------------------
$date = `date`;
chomp($date);
if($paired){
my $sc_start_message = "\n=>Scaffolding initiated $date\n";
print $sc_start_message;
print LOG $sc_start_message;
$assemblyruninfo.= $sc_start_message . "\n";
my $pair = &pairContigs($matepair, $track_all, $tig_length, $issues, $distribution, $verbose);
&buildScaffolds($pair, $tig_length, $contig_size_cutoff, $verbose);
close SC;
$date = `date`;
chomp($date);
my $sc_end_message = "\nScaffolding ended $date\n";
print $sc_end_message;
print LOG $sc_end_message;
$assemblyruninfo.= $sc_end_message . "\n";
$date = `date`;
chomp($date);
my $sc_fasta_message = "\n\n=>Making scaffold FASTA file: $date\n";
print $sc_fasta_message;
print LOG $sc_fasta_message;
$assemblyruninfo.= $sc_fasta_message . "\n";
### reading contigs to make fasta file and get additional needed info
my ($tighash, $tignames, $tig_length) = &readContigsMemory($contig);
### building scaffold fasta
&buildScaffoldFasta($scaffold,$tighash,$scaffold_fasta);
my $sc_fasta_done_message = "Scaffolds FASTA in: $scaffold_fasta\n";
print $sc_fasta_done_message;
print LOG $sc_fasta_done_message;
$assemblyruninfo.= $sc_fasta_done_message . "\n";
### DEPRECATED FEATURE JAN2018 (force-fill gap)
#$date = `date`;
#chomp($date);
#my $me_start_message = "\n=>Merging contigs initiated $date\n";
#print $me_start_message;
#print LOG $me_start_message;
#$assemblyruninfo.= $me_start_message . "\n";
#&forcefillGaps($scaffold, $contig, $mergedtigs, $verbose, $min_tig_overlap, $max_count_trim, $npad_gaps, $alternate, $matepair, $min_overlap, $base_overlap, $min_base_ratio, $forcetrack, $max_trim, $encoded,$seedsplit,$space_restriction,$targetwordlen,$insert_stdev);
#$date = `date`;
#chomp($date);
#my $me_end_message = "\nMerging contigs ended $date\n";
#print $me_end_message;
#print LOG $me_end_message;
#$assemblyruninfo.= $me_end_message . "\n";
}
close LOG;
exit;
###for dev. test purposes
eval{
my $wdir = `pwd`;
chomp($wdir);
# my $smtp = Net::SMTP->new('mailhost');
# $smtp->mail("SSAKE\@bcgsc.ca");
# $smtp->to($dev);
# $smtp->data();
# $smtp->datasend("Subject: Your SSAKE run\n");
# $smtp->datasend("At: $wdir\n");
# $smtp->datasend($assemblyruninfo);
# $smtp->dataend();
# $smtp->quit;
};
exit;
#-----------------------
sub collectOverhang{
my ($overhang,$newpass,$dangle,$set,$verbose) = @_;
my @over = split(//,$dangle);
my $ct_oh = 0;
foreach my $bz(@over){
$ct_oh++; ### tracks overhang position passed the seed
$overhang->{$ct_oh}{$bz} += $set->{$newpass}{'count'}; ### reflects read coverage (often real duplicates)
print "$ct_oh - $bz = $overhang->{$ct_oh}{$bz}\n" if($verbose);
}
return $overhang;
}
#------------------------------------
#Order and orient contigs into scaffolds
sub buildScaffolds{
my ($pair, $tig_length, $contig_size_cutoff, $verbose) = @_;
my $seen_it;
my $sc_ct = 0;
#print SC "Scaffold Number,Scaffold Size (only contig lengths considered),Scaffold Chain: e.g. _f127z7068k12a0.58m42_r3090z62k7r0.14m76_ means: contig127(+ strand=f), size 7068 (z) has 12 links (k), link ratio of 0.58 (a) and with a mean gap/overlap of 42nt (m) with reverse (r) of contig3090 (size 62) on the right.\n";
SEED:
foreach my $tig (sort {$tig_length->{$b}<=>$tig_length->{$a}} keys %$tig_length){
my $ftig = "f" . $tig;
my $rtig = "r" . $tig;
if(! defined $seen_it->{$tig}){##should prevent re-using a contig as seed if it's already been incorporated into a scaffold
$sc_ct++;
my $chainleft = "";
my $ori_chainright = $ftig . "Z" . $tig_length->{$tig};
my $chainright = $ori_chainright;
my $total = $tig_length->{$tig};
($total, $chainright, $seen_it) = &computeLayout("R", $chainright, $ftig, $pair, $tig_length, $total, $seen_it, $tig);
($total, $chainleft, $seen_it) = &computeLayout("L", $chainleft, $rtig, $pair, $tig_length, $total, $seen_it, $tig);
$seen_it->{$tig}++;
delete $pair->{$ftig};
delete $pair->{$rtig};
delete $tig_length->{$tig};
my $scaffold = $chainleft . $chainright;
print SC "scaffold" . $sc_ct . ",$total,$scaffold\n" if($total >= $contig_size_cutoff);
}
}
}
#------------------------------------
# links contigs together into a chain - must satisfy user-defined criterions (-k -a)
sub computeLayout{
my ($ext, $chain, $tig, $pair, $tig_length, $total, $seen_it, $orig_tig_number) = @_;
my $orig_tig = $tig;
my $extension = 1;
EXTENSION:
while($extension){
my $tnum = $1 if($tig=~/[fr](\d+)/);
my $tnumf = "f" . $tnum;
my $tnumr = "r" . $tnum;
if(! defined $seen_it->{$tnum}){
$seen_it->{$tnum}++ if($tnumf ne $orig_tig);
print "Attempt to extend $tig\n" if ($verbose);
my $list = $pair->{$tig};
my ($match1,$link1,$gaps1,$match2,$link2,$gaps2,$cntloop)=("",0,0,"",0,0,0);
LINK:
foreach my $match (sort {$list->{$b}{'links'}<=>$list->{$a}{'links'}} keys %$list){
if($cntloop){
($match2,$link2,$gaps2) = ($match,$list->{$match}{'links'},$list->{$match}{'gaps'});
print "$tig links second best $match2 (links:$link2 total sz:$gaps2)\n" if ($verbose);
last LINK;
}else{
($match1,$link1,$gaps1) = ($match,$list->{$match}{'links'},$list->{$match}{'gaps'});
print "$tig links best $match1 (links:$link1 total sz:$gaps1)\n" if ($verbose);
}
$cntloop++;
}
###ratio
my $ratio = 0.00;
$ratio = $link2 / $link1 if ($link1); ## relative ratio of the two most abundant contig pairs
if ($ratio =~ /(\d+\.\d{2})/){$ratio = $1;}
###mean
my $mean = 0;
$mean = int($gaps1 / $link1) if ($link1);
my $tempnum = $1 if($match1 =~ /[fr](\d+)/);
#### Assessment
if(defined $seen_it->{$tempnum} || $link1 < $min_links || $ratio > $max_link_ratio || $tempnum == $orig_tig_number){
$extension = 0;
print "defined seen_it->{ $tempnum } || $link1 < $min_links || $ratio > $max_link_ratio\n L1:$link1 L2:$link2 M1:$match1 M2:$match2 G1:$gaps1 G2:$gaps2 " if ($verbose);
last EXTENSION;
}{### pass filter.. does this contig
print "$ext extension. mean: $mean links:$link1 linkratio:$ratio\n" if ($verbose);
if($ext eq "R"){
$chain .= "k" . $link1 . "a" . $ratio . "m" . $mean . "_" . $match1 . "z" . $tig_length->{$tempnum};
}else{
my $temp_match = "";
if($match1 =~ /^r(\d+)/){$temp_match = "f" . $1;}else{$temp_match = "r". $1;}
$chain = $temp_match . "z" . $tig_length->{$tempnum} . "k" . $link1 . "a" . $ratio . "m" . $mean . "_" . $chain;
}
$total += $tig_length->{$tempnum};
print "NEXT TIG TO LOOK AT= $match1\n" if ($verbose);
$tig = $match1;
$extension = 1;
print "Will flag $tnum as seen (only if $tnumf != $orig_tig)." if ($verbose);
if($tnumf ne $orig_tig){
delete $pair->{$tnumf};
delete $pair->{$tnumr};
delete $tig_length->{$tnum};
}else{
delete $pair->{$tnumf};
}
}
}else{
print "NO MORE MATCH FOR $tig in hash: pair>>\n" if ($verbose);
$extension = 0;
last EXTENSION;
}
}### pair is defined
return $total, $chain, $seen_it;
}
#------------------------------------
sub trackReads{
my ($track, $track_all, $alternate, $tig_count) = @_;
foreach my $rd (keys %$track){
if(! defined $track_all->{$rd}){
$track_all->{$rd}{'tig'} = $tig_count;
$track_all->{$rd}{'start'} = $track->{$rd}{'start'};
$track_all->{$rd}{'end'} = $track->{$rd}{'end'};
$alternate->{$tig_count}{$track->{$rd}{'start'}}{$rd} = $track->{$rd}{'end'};
delete $track->{$rd};
}
}
return $track_all,$alternate;
}
#------------------------------------
sub getDistance{
my ($insert_size, $length_i, $start_i, $start_j) = @_;
# L ------ --------- R
# i -> <- j
# .... ...... insert_span
# ============ insert_size
my $insert_span = ($length_i - $start_i) + $start_j;
my $gap_or_overlap = $insert_size - $insert_span;
return $gap_or_overlap;
}
#-----------------
#build contig pairs based on template information - must satisfy user-defined criterions (-d -e)
sub pairContigs{
my ($matepair,$track,$tig_length,$issues,$distribution,$verbose) = @_;
my ($ct_illogical, $ct_ok_contig, $ct_ok_pairs, $ct_problem_pairs, $ct_iz_issues, $ct_single, $ct_both)= (0,0,0,0,0,0,0);
my $ct_illogical_hash;
my $ct_ok_contig_hash;
my $ct_ok_pairs_hash;
my $ct_problem_pairs_hash;
my $ct_iz_issues_hash;
my $ct_single_hash;
my $ct_both_hash;
my ($pair,$err,$track_insert);
print "Pairing contigs...\n" if ($verbose);
open(PET, ">$issues") || die "Can't open $issues for writing -- fatal\n";
foreach my $read_a (keys %$matepair){
my $mateslist = $matepair->{$read_a};
foreach my $read_b (keys %$mateslist){
if(! $matepair->{$read_a}{$read_b}{'bt'} && ! $matepair->{$read_b}{$read_a}{'bt'}){
##2 lines below indicates this specific pair has been seen
$matepair->{$read_a}{$read_b}{'bt'}=1;
$matepair->{$read_b}{$read_a}{'bt'}=1;
my $insert_size = $mateslist->{$read_b}{'is'};
my $min_allowed = -1 * ($insert_stdev * $insert_size);
my ($low_iz, $up_iz) = ($insert_size + $min_allowed, $insert_size - $min_allowed);
print "Pair read1=$read_a read2=$read_b\n" if ($verbose);
if(defined $track->{$read_a}{'tig'} && defined $track->{$read_b}{'tig'}){### both pairs assembled
$ct_both++;
$ct_both_hash->{$insert_size}++;
my $tig_a = $track->{$read_a}{'tig'};
my $tig_b = $track->{$read_b}{'tig'};
my $ftig_a = "f" . $tig_a;
my $ftig_b = "f" . $tig_b;
my $rtig_a = "r" . $tig_a;
my $rtig_b = "r" . $tig_b;
my $A_length = $tig_length->{$tig_a};
my $A_start = $track->{$read_a}{'start'};
my $A_end = $track->{$read_a}{'end'};
my $B_length = $tig_length->{$tig_b};
my $B_start = $track->{$read_b}{'start'} ;
my $B_end = $track->{$read_b}{'end'};
if ($tig_a != $tig_b){####paired reads located on <> contigs
####Determine most likely possibility
if ($track->{$read_a}{'start'} < $track->{$read_a}{'end'}){
if ($track->{$read_b}{'end'} < $track->{$read_b}{'start'}){####-> <- ::: A-> <-B / rB -> <- rA
my $d = &getDistance($insert_size, $A_length, $A_start, $B_start);
print "A-> <-B WITH $tig_a -> <- $tig_b GAP $d A=$A_length ($A_start-$A_end) B=$B_length ($B_start-$B_end) Alen, Astart,Bstart\n" if($verbose);
if($d >= $min_allowed){
$pair->{$ftig_a}{$ftig_b}{'links'}++;
$pair->{$ftig_a}{$ftig_b}{'gaps'} += $d;
$pair->{$rtig_b}{$rtig_a}{'links'}++;
$pair->{$rtig_b}{$rtig_a}{'gaps'} += $d;
$ct_ok_pairs++;
$ct_ok_pairs_hash->{$insert_size}++;
}else{
my $err_pair = $ftig_a . "-". $ftig_b;
$err->{$err_pair}{'links'}++;
$err->{$err_pair}{'gaps'} += $d;
$ct_problem_pairs++;
$ct_problem_pairs_hash->{$insert_size}++;
print PET "Pairs unsatisfied in distance within a contig pair. A-> <-B WITH tig#$tig_a -> $d <- tig#$tig_b, A=$A_length nt (start:$A_start, end:$A_end) B=$B_length nt (start:$B_start, end:$B_end) CALCULATED DISTANCE APART: $d < $min_allowed\n";
}
}else{#### -> -> ::: A-> <-rB / B-> <-rA
my $rB_start = $B_length - $B_start;
my $d = &getDistance($insert_size, $A_length, $A_start, $rB_start);
print "A-> <-rB WITH $tig_a -> <- r.$tig_b GAP $d A=$A_length ($A_start-$A_end) B=$B_length ($B_start-$B_end) Alen,Astart,rBstart\n" if($verbose);
if($d >= $min_allowed){
$pair->{$ftig_a}{$rtig_b}{'links'}++;
$pair->{$ftig_a}{$rtig_b}{'gaps'} += $d;
$pair->{$ftig_b}{$rtig_a}{'links'}++;
$pair->{$ftig_b}{$rtig_a}{'gaps'} += $d;
$ct_ok_pairs++;
$ct_ok_pairs_hash->{$insert_size}++;
}else{
my $err_pair = $ftig_a . "-". $rtig_b;
$err->{$err_pair}{'links'}++;
$err->{$err_pair}{'gaps'} += $d;
$ct_problem_pairs++;
$ct_problem_pairs_hash->{$insert_size}++;
print PET "Pairs unsatisfied in distance within a contig pair. A-> <-rB WITH tig#$tig_a -> $d <- tig#r.$tig_b, A=$A_length nt (start:$A_start, end:$A_end) B=$B_length nt (start:$B_start, end:$B_end) CALCULATED DISTANCE APART: $d < $min_allowed\n";
}
}
}else{
if ($track->{$read_b}{'end'} > $track->{$read_b}{'start'}){####<- -> ::: B-> <-A / rA -> <- rB
my $d = &getDistance($insert_size, $B_length, $B_start, $A_start);
print "B-> <-A WITH $tig_b -> <- $tig_a GAP $d A=$A_length ($A_start-$A_end) B=$B_length ($B_start-$B_end) Blen,Bstart,Astart\n" if($verbose);
if($d >= $min_allowed){
$pair->{$ftig_b}{$ftig_a}{'links'}++;
$pair->{$ftig_b}{$ftig_a}{'gaps'} += $d;
$pair->{$rtig_a}{$rtig_b}{'links'}++;
$pair->{$rtig_a}{$rtig_b}{'gaps'} += $d;
$ct_ok_pairs++;
$ct_ok_pairs_hash->{$insert_size}++;
}else{
my $err_pair = $ftig_b . "-". $ftig_a;
$err->{$err_pair}{'links'}++;
$err->{$err_pair}{'gaps'} += $d;
$ct_problem_pairs++;
$ct_problem_pairs_hash->{$insert_size}++;
print PET "Pairs unsatisfied in distance within a contig pair. B-> <-A WITH tig#$tig_b -> $d <- tig#$tig_a, B=$B_length nt (start:$B_start, end:$B_end) A=$A_length nt (start:$A_start, end:$A_end) CALCULATED DISTANCE APART: $d < $min_allowed\n";
}
}else{ ####<- <- ::: rB-> <-A / rA-> <-B
my $rB_start = $B_length - $B_start;
my $d = &getDistance($insert_size, $B_length, $rB_start, $A_start);
print "rB-> <-A WITH r.$tig_b -> <- $tig_a GAP $d A=$A_length ($A_start-$A_end) B=$B_length ($B_start-$B_end) Blen,rBstart,Astart\n" if($verbose);
if($d >= $min_allowed){
$pair->{$rtig_b}{$ftig_a}{'links'}++;
$pair->{$rtig_b}{$ftig_a}{'gaps'} += $d;
$pair->{$rtig_a}{$ftig_b}{'links'}++;
$pair->{$rtig_a}{$ftig_b}{'gaps'} += $d;
$ct_ok_pairs++;
$ct_ok_pairs_hash->{$insert_size}++;
}else{
my $err_pair = $rtig_b . "-". $ftig_a;
$err->{$err_pair}{'links'}++;
$err->{$err_pair}{'gaps'} += $d;
$ct_problem_pairs++;
$ct_problem_pairs_hash->{$insert_size}++;
print PET "Pairs unsatisfied in distance within a contig pair. rB-> <-A WITH tig#r.$tig_b -> $d <- tig#$tig_a, B=$B_length nt (start:$B_start, end:$B_end) A=$A_length nt (start:$A_start, end:$A_end) CALCULATED DISTANCE APART: $d < $min_allowed\n";
}
}
}
#print Dumper($pair);
}else{###Clone, paired reads located on the same contig -- could be used to investigate misassemblies
print "Pair ($read_a and $read_b) located on same contig $tig_a ($A_length nt)\n" if ($verbose);
my $pet_size = 0;
if ($A_start > $B_start && ($B_start < $B_end) && ($A_start > $A_end)){ # B --> <-- A
$pet_size = $A_start - $B_start;
$track_insert->{$pet_size}++;
if($pet_size >= $low_iz && $pet_size <= $up_iz){
$ct_ok_contig++;
$ct_ok_contig_hash->{$insert_size}++;
}else{
print PET "Pairs unsatisfied in distance within a contig. Pair ($read_a - $read_b) on contig $tig_a ($A_length nt) Astart:$A_start Aend:$A_end Bstart:$B_start Bend:$B_end CALCULATED DISTANCE APART: $pet_size\n";
$ct_iz_issues++;
$ct_iz_issues_hash->{$insert_size}++;
}
}elsif($B_start > $A_start && ($B_start > $B_end) && ($A_start < $A_end)){ # A --> <-- B
$pet_size = $B_start - $A_start;
$track_insert->{$pet_size}++;
if($pet_size >= $low_iz && $pet_size <= $up_iz){
$ct_ok_contig++;
$ct_ok_contig_hash->{$insert_size}++;
}else{
print PET "Pairs unsatisfied in distance within a contig. Pair ($read_a - $read_b) on contig $tig_a ($A_length nt) Astart:$A_start Aend:$A_end Bstart:$B_start Bend:$B_end CALCULATED DISTANCE APART: $pet_size\n";
$ct_iz_issues++;
$ct_iz_issues_hash->{$insert_size}++;
}
}else{
$ct_illogical++;
$ct_illogical_hash->{$insert_size}++;
print PET "Pairs unsatisfied in pairing logic within a contig. Pair ($read_a - $read_b) on contig $tig_a ($A_length nt) Astart:$A_start Aend:$A_end Bstart:$B_start Bend:$B_end\n";
}
}
}else{###both pairs assembled
$ct_single++;
$ct_single_hash->{$insert_size}++;
}
}#if unseen
}#pairing read b
}#read a
### summary of contig pair issues
print PET "------------- Putative issues with contig pairing - Summary ----------------\n";
foreach my $err_pair (sort {$err->{$b}{'links'}<=>$err->{$a}{'links'}} keys %$err){
my $mean_iz = 0;
$mean_iz = $err->{$err_pair}{'gaps'} / $err->{$err_pair}{'links'} if ($err->{$err_pair}{'links'});
print PET "Pair $err_pair has $err->{$err_pair}{'links'} links and mean distance = $mean_iz\n";
}
close PET;
my $satisfied = $ct_ok_pairs + $ct_ok_contig;
my $unsatisfied = $ct_problem_pairs + $ct_iz_issues + $ct_illogical;
my $ct_both_reads = $ct_both * 2;
print LOG "\n===========PAIRED-END READS STATS===========\n";
print LOG "At least one sequence/pair missing from contigs >= $contig_size_cutoff bp (user-defined -z): $ct_single\n";
print LOG "Assembled pairs: $ct_both ($ct_both_reads sequences)\n";
print LOG "\tSatisfied in distance/logic within contigs (i.e. -> <-, distance on target: $ct_ok_contig\n";
print LOG "\tUnsatisfied in distance within contigs (i.e. distance out-of-bounds): $ct_iz_issues\n";
print LOG "\tUnsatisfied pairing logic within contigs (i.e. illogical pairing ->->, <-<- or <-->): $ct_illogical\n";
print LOG "\t---\n";
print LOG "\tSatisfied in distance/logic within a given contig pair (pre-scaffold): $ct_ok_pairs\n";
print LOG "\tUnsatisfied in distance within a given contig pair (i.e. calculated distances out-of-bounds): $ct_problem_pairs\n";
print LOG "\t---\n";
print LOG "Total satisfied: $satisfied\tunsatisfied: $unsatisfied\n\nBreakdown by insert sizes:\n";
foreach my $izopt(sort {$a<=>$b} keys %$ct_both_hash){
print LOG "--------Reads with $izopt bp inserts--------\n";
my $maopt = -1 * ($insert_stdev * $izopt);
my ($low_izopt, $up_izopt) = ($izopt + $maopt, $izopt - $maopt);
print LOG "MIN:$low_izopt MAX:$up_izopt as defined by $izopt * $insert_stdev\n";
print LOG "At least one sequence/pair missing from contigs >= $contig_size_cutoff bp (user-defined -z): $ct_single_hash->{$izopt}\n";
print LOG "Assembled pairs: $ct_both_hash->{$izopt}\n";
print LOG "\tSatisfied in distance/logic within contigs (i.e. -> <-, distance on target: $ct_ok_contig_hash->{$izopt}\n";
print LOG "\tUnsatisfied in distance within contigs (i.e. distance out-of-bounds): $ct_iz_issues_hash->{$izopt}\n";
print LOG "\tUnsatisfied pairing logic within contigs (i.e. illogical pairing ->->, <-<- or <-->): $ct_illogical_hash->{$izopt}\n";
print LOG "\t---\n";
print LOG "\tSatisfied in distance/logic within a given contig pair (pre-scaffold): $ct_ok_pairs_hash->{$izopt}\n";
print LOG "\tUnsatisfied in distance within a given contig pair (i.e. calculated distances out-of-bounds): $ct_problem_pairs_hash->{$izopt}\n";
}
print LOG "============================================\n";
open (CSV, ">$distribution") || die "Can't open $distribution for writing -- fatal";
foreach my $is (sort {$a<=>$b} keys %$track_insert){
print CSV "$is,$track_insert->{$is}\n";
}
close CSV;
return $pair;
}
#-----------------
# SSAKE contig extension
sub doExtension{
my ($direction, $orig_mer, $seq, $set, $bin, $reads_needed, $total_bases, $min_overlap, $base_overlap, $min_base_ratio, $verbose, $track, $paired, $tig_count, $max_trim, $e, $matepair, $tie_breaker, $ignore_read, $barcodeList) = @_;
my $extended = 1;
my $trim_ct = 0; #trim counter - keeps track of 3'-end trim
if($orig_mer > $MAX){$orig_mer=$MAX;} ### Deals with special cases where the seed sequences are different from the read set (and possibly very large) - goal here is not to increase sequence coverage of seed, but rather to extend it.
TRIM:
while($trim_ct <= $max_trim){
while($extended){
my $growing_tig_length = length($seq);
my ($pos,$span) = (0,"");
### Added 15January18 =====================================
if($growing_tig_length >= $MAX){ # $seq is length of contig being extended -- if larger than largest read, make sure the largest read could align and all subsequent rds.
$span = $MAX - $TRACK_COUNT;
}else{
$span = $growing_tig_length - $TRACK_COUNT;
}
### NEW ADD JAN 2018
while ($span >= $min_overlap){ # will slide the subseq, until the user-defined min overlap size
$pos = $growing_tig_length - $span;
print "MAX:$MAX, SPAN:$span, POS:$pos" if ($verbose);
my $subseq = substr($seq, $pos, $span); #make a sub-sequence of length l-(1..i) for searching
my @s = $subseq =~ /\S{4}/g;
my $subset = $bin->{$e->{$s[0]}}{$e->{$s[1]}}{$e->{$s[2]}}{$e->{$s[3]}}; #Will grab everything even the reverse complement ones
print "####$direction SEARCH Position:$pos Span:$span - Subseq:$subseq Previous:$seq\n" if ($verbose);
### SEARCH -- this cycles through limited k-mer space
foreach my $pass (sort {$subset->{$b} <=> $subset->{$a}} keys %$subset){
if($pass =~ /^$subseq([ACGT]+)/ || $subseq =~ /$pass/){#### OVERHANG || EMBEDDED
#print "BC $subset->{$pass}\n";
if(defined $barcodeList->{$subset->{$pass}}){### barcode seen before
if((length($seq) - $barcodeList->{$subset->{$pass}}{'lastlength'}) > $LR_MAXDIST_APART){
$barcodeList->{$subset->{$pass}}{'count'}=0; ### reset barcode to zero, too far apart, new molecule
}
}
$barcodeList->{$subset->{$pass}}{'lastlength'}=length($seq);### new tracks all barcodes encountered
$barcodeList->{$subset->{$pass}}{'count'}++;### new tracks all barcodes encountered
}
}
$span--;
}#while overlap >= user-defined -m minimum
### END NEW ADDITION==========================================
### Added 19March08
($pos,$span) = (0,"");
if($growing_tig_length >= $MAX){ # $seq is length of contig being extended -- if larger than largest read, make sure the largest read could align and all subsequent rds.
$span = $MAX - $TRACK_COUNT;
}else{
$span = $growing_tig_length - $TRACK_COUNT;
}
my $overhang = {};
my $overlapping_reads = {};
my $long = 0;
for (my $x=1;$x <= ($orig_mer * 2);$x++){
($overhang->{$x}{'A'},$overhang->{$x}{'C'},$overhang->{$x}{'G'},$overhang->{$x}{'T'}) = (0,0,0,0);
}
### COLLECT SEQUENCES
while ($span >= $min_overlap){ # will slide the subseq, until the user-defined min overlap size
$pos = $growing_tig_length - $span;
print "MAX:$MAX, SPAN:$span, POS:$pos" if ($verbose);
my $subseq = substr($seq, $pos, $span); #make a sub-sequence of length l-(1..i) for searching
my @s = $subseq =~ /\S{4}/g;
my $subset = $bin->{$e->{$s[0]}}{$e->{$s[1]}}{$e->{$s[2]}}{$e->{$s[3]}}; #Will grab everything even the reverse complement ones
print "####$direction SEARCH Position:$pos Span:$span - Subseq:$subseq Previous:$seq\n" if ($verbose);
### SEARCH -- this cycles through limited k-mer space
foreach my $pass (sort {$subset->{$b} <=> $subset->{$a}} keys %$subset){
if($pass =~ /^$subseq([ACGT]+)/){#### OVERHANG
#can we align perfectly that subseq to another rd start?
my $dangle = $1;
print "\n", "=" x 80, "\n$direction'- FOUND sequence: $pass -> subset: $subseq -> overhang: $dangle\n", "=" x 80, "\n\n" if ($verbose);
#---------------------------------
my $psr;
my $pass_rc = reverseComplement($pass);
if(defined $set->{$pass}){
$psr->{$pass}{'start'} = $pos + 1;
$psr->{$pass}{'end'} = $pos + length($pass);
}
if(defined $set->{$pass_rc}){
$psr->{$pass_rc}{'start'} = $pos + length($pass_rc);
$psr->{$pass_rc}{'end'} = $pos + 1;
}
###############################################
# CONSIDER CERTAIN READS FOR OVERLAP, PREFERABLY THOSE WITH LOGICAL MATES AND FWD READS IN TIG LARGE ENOUGH TO HAVE SUCH PAIRS
foreach my $newpass(keys %$psr){
if((length($seq)<=2000 || ((length($seq)>2000 || length($seq)<=10000) && $barcodeList->{$subset->{$newpass}}{'count'}>4) || (length($seq)>10000 && $barcodeList->{$subset->{$newpass}}{'count'}>=9 ) ) && $paired && defined $matepair->{$newpass} && ($psr->{$newpass}{'end'} < $psr->{$newpass}{'start'}) && ($psr->{$newpass}{'start'} >= $set->{$newpass}{'grace'})){#paired, pairingRds, <---, outside grace
#print "$B_end <-- $B_start *** [upper limit is grace]***\n";
# <--B
#========
my $mateshash = $matepair->{$newpass};
MATESEARCH:
foreach my $matchingread (keys %$mateshash){
if(defined $track->{$matchingread}){ #a mate has been found on this contig
my $insert_size = $mateshash->{$matchingread}{'is'};
my $min_allowed = -1 * ($insert_stdev * $insert_size);
my ($low_iz, $up_iz) = ($insert_size + $min_allowed, $insert_size - $min_allowed);
my $A_start = $track->{$matchingread}{'start'};
my $A_end = $track->{$matchingread}{'end'};
my $pet_size = $psr->{$newpass}{'start'} - $A_start;
print "\t$newpass ($psr->{$newpass}{'start'} - $psr->{$newpass}{'end'}) and $matchingread ($A_start - $A_end ) are on same tig#$tig_count [$low_iz to $up_iz]\n" if($verbose);
if(($psr->{$newpass}{'start'} > $A_start) && ($A_start < $A_end) && ($pet_size >= $low_iz) && ($pet_size <= $up_iz)){ # A --> <-- B(candidate for extension)
#print "\tTRACKING $psr->{$newpass}{'start'} > $A_start && ($psr->{$newpass}{'start'} > $psr->{$newpass}{'end'}) && ($A_start < $A_end)\n" if($verbose);
$overhang = collectOverhang($overhang,$newpass,$dangle,$set,$verbose);
$overlapping_reads->{$pass}++;
$long=1 if(length($newpass) > $illuminaLengthCutoff);
last MATESEARCH;
}
}
}
}elsif(length($seq)<=2000 || ((length($seq)>2000 || length($seq)<=10000) && $barcodeList->{$subset->{$newpass}}{'count'}>4) || (length($seq)>10000 && $barcodeList->{$subset->{$newpass}}{'count'}>=9 ) ){### not paired or paired (B-->): collect all overlaps
$overhang = collectOverhang($overhang,$newpass,$dangle,$set,$verbose);
$overlapping_reads->{$pass}++;
$long=1 if(length($newpass) > $illuminaLengthCutoff);
}
}###for $newpass
#----------------------------------
}elsif($subseq =~ /$pass/){ #### EMBEDDED
my $complement_pass = reverseComplement($pass);
print "$pass found in $subseq ($set->{$pass}{'count'}) - deleting read: $pass and complement ($set->{$complement_pass}): $complement_pass\n\n" if ($verbose);
if(defined $set->{$pass}){
my $current_reads = $set->{$pass}{'count'};
my $current_bases = length($pass) * $current_reads;
$reads_needed += $current_reads;
$total_bases += $current_bases;
if($paired){
$track->{$pass}{'start'} = $pos + 1;
$track->{$pass}{'end'} = $pos + length($pass);
$track->{$pass}{'cov'} = $current_reads;
$track->{$pass}{'names'} = $set->{$pass}{'names'};
}
($bin,$set,$seed) = deleteData($bin,$set,$seed,$pass,$e);
#print "EMBED .. $pass ($current_reads)\n";
}
if(defined $set->{$complement_pass}){
my $current_reads = $set->{$complement_pass}{'count'};
my $current_bases = length($complement_pass) * $current_reads;
$reads_needed += $current_reads;
$total_bases += $current_bases;
if($paired){
$track->{$complement_pass}{'end'} = $pos + 1;
$track->{$complement_pass}{'start'} = $pos + length($complement_pass);
$track->{$complement_pass}{'cov'} = $current_reads;
$track->{$complement_pass}{'names'} = $set->{$complement_pass}{'names'};
}
($bin,$set,$seed) = deleteData($bin,$set,$seed,$complement_pass,$e);
#print "EMBED .. $complement_pass ($current_reads)\n";
}
}
}
$span--;
}#while overlap >= user-defined -m minimum
my $consensus = "";
print "Finished Collecting Overlapping Reads - BUILDING CONSENSUS...\n" if ($verbose);
print Dumper(%$overlapping_reads) if ($verbose);
my $tmp_base_overlap = $base_overlap;
if($long){
$tmp_base_overlap = 2;
}
### Build consensus
CONSENSUS:
foreach my $ohpos (sort {$a<=>$b} keys %$overhang){
if($ohpos){
my $coverage = $overhang->{$ohpos}{'A'}+$overhang->{$ohpos}{'C'}+$overhang->{$ohpos}{'G'}+$overhang->{$ohpos}{'T'};
print "pos:$ohpos cov:$coverage A:$overhang->{$ohpos}{'A'} C:$overhang->{$ohpos}{'C'} G:$overhang->{$ohpos}{'G'} T:$overhang->{$ohpos}{'T'}\n" if($verbose);
if ($coverage < $tmp_base_overlap){
print "COVERAGE BELOW THRESHOLD: $coverage < -o $tmp_base_overlap @ $ohpos :: will extend by: $consensus\n" if ($verbose);
last CONSENSUS;
}
my $baselist = $overhang->{$ohpos};
my $ct_dna=0;
my $previous_bz = "";
BASE:
foreach my $bz (sort {$baselist->{$b}<=>$baselist->{$a}} keys %$baselist){
#print "\t$ct_dna -> $bz..$baselist->{$previous_bz} > $baselist->{$bz}\n";
if($ct_dna){## the two most abundant bases at that position
#print "\t\t$ct_dna\n";
if($previous_bz ne "" && ($baselist->{$previous_bz} / $coverage) >= $min_base_ratio && $baselist->{$previous_bz} > $baselist->{$bz}){### a simple consensus btw top 2
$consensus .= $previous_bz; ### build consensus
print "Added base $previous_bz (cov = $baselist->{$previous_bz}) to $consensus **\n" if ($verbose);
last BASE;
}else{
###RLW2014
if($previous_bz ne "" && $tie_breaker && $coverage <= 2){### testing limit coverage
$consensus .= $previous_bz; ### build consensus
print "Added base $previous_bz (cov = $baselist->{$previous_bz}) to $consensus (Forced by -q $tie_breaker) **\n" if ($verbose);
last BASE;
}else{
print "ISSUES EXTENDING: best base = $previous_bz (cov=$baselist->{$previous_bz}) at $ohpos. Second-Best: $bz (cov=$baselist->{$bz}) (ratio best=$baselist->{$previous_bz} / total=$coverage) >= $min_base_ratio (-r) -- will terminate with $consensus\n" if($verbose);
last CONSENSUS;
}
}
}
$previous_bz = $bz;
$ct_dna++;
}
}
}
$long = 0;
if($ignore_read==0){###new option to ignore read mapping
### deal with sequence reads making up the consensus/newly formed contig
if($consensus ne ""){
print "Will extend $seq\nwith: $consensus\n\n" if($verbose);
my $temp_sequence = $seq . $consensus;
my $position_buffer = 0;
if($growing_tig_length > $MAX){
$temp_sequence = substr($seq,$growing_tig_length-$MAX,$MAX) . $consensus;
$position_buffer = $growing_tig_length-$MAX;
}
my $integral = 0;
my $temp_sequence_portion = "-" x length($temp_sequence);
foreach my $ro (keys %$overlapping_reads){
my $or_pos = -99;
while($temp_sequence =~ /$ro/g){ ### want the last position
$or_pos = pos($temp_sequence);
}
if($or_pos > 0){
###TRACK COVERAGE TO PREVENT FAULTY EXTENSIONS
my $linestring = '.' x length($ro);
substr ($temp_sequence_portion,$or_pos,length($ro),$linestring);
$or_pos += $position_buffer;
my $complement_ro = reverseComplement($ro);
print "$ro found in $seq ($set->{$ro}{'count'}) - deleting read: $ro and complement ($set->{$complement_ro}{'count'}): $complement_ro\n\n" if ($verbose);
if(defined $set->{$ro}){
my $current_reads = $set->{$ro}{'count'};
#print "fwd SET:$current_reads BIN $subset->{$ro}\n";
my $current_bases = length($ro) * $current_reads;
$integral += $current_reads;
$reads_needed += $current_reads;
$total_bases += $current_bases;
if($paired){
$track->{$ro}{'start'} = $or_pos - length($ro) + 1;
$track->{$ro}{'end'} = $or_pos;
$track->{$ro}{'cov'} = $current_reads;
$track->{$ro}{'names'} = $set->{$ro}{'names'};
#my $lro=length($ro);
#print "OVER FWD\n$seq ($growing_tig_length)\n$temp_sequence\n$consensus\n$ro ($current_reads)\tend=$or_pos ($track->{$ro}{'start'}-$track->{$ro}{'end'})\n\n";
}
($bin,$set,$seed) = deleteData($bin,$set,$seed,$ro,$e);
}
if(defined $set->{$complement_ro}){
my $current_reads = $set->{$complement_ro}{'count'};
#print "rc SET:$current_reads BIN $subset_rc->{$complement_ro}\n";
my $current_bases = length($complement_ro) * $current_reads;
$integral += $current_reads;
$reads_needed += $current_reads;
$total_bases += $current_bases;
if($paired){
$track->{$complement_ro}{'end'} = $or_pos - length($ro) + 1;
$track->{$complement_ro}{'start'} = $or_pos;
$track->{$complement_ro}{'cov'} = $current_reads;
$track->{$complement_ro}{'names'} = $set->{$complement_ro}{'names'};
#my $lro=length($ro);
#print "OVER REV\n$seq ($growing_tig_length)\n$temp_sequence\n$consensus\n$complement_ro ($current_reads)\tstart=$or_pos($track->{$complement_ro}{'start'}-$track->{$complement_ro}{'end'})\n\n";
}
($bin,$set,$seed) = deleteData($bin,$set,$seed,$complement_ro,$e);
}
}
}
#if(! $integral){### no reads are found overlapping with the consensus might be indicative of low complexity regions -- Stop the extension
if($integral < $tmp_base_overlap){
print "No overlapping reads agree with the consensus or number of agreeing reads is lower than target coverage (tmp:$tmp_base_overlap -o $base_overlap). Stopping extension" if ($verbose);
$extended = 0;
}else{
###Added R.Warren 5/5/2010
if($temp_sequence_portion =~ /\.(\-*)?$/){### will not extend a contig with 3' consensus bases if no reads overlap them (mitigate assembly errors)
$consensus = substr($consensus,0,length($consensus)-length($1));
}
###
$seq .= $consensus; ##### contig extension
print "New Contig is: $seq\n" if ($verbose);
$extended = 1;
}
}else{### no consensus built, will stop the extension
$extended = 0;
}
}else{###New option Dec2014 to ignore reads making up consensus
if($consensus ne ""){
$seq .= $consensus; ##### contig extension
print "ALLA New Contig is: $seq\n" if ($verbose);
$extended = 1;
}else{
$extended = 0;
}
}
print "IGNORE:$ignore_read\n" if ($verbose);
}###while get the OK for extension
$trim_ct++;
if ($trim_ct <= $max_trim){
last TRIM if (length($seq) <= $MIN_READ_LENGTH); #terminate assembly if trimming becomes too agressive
$seq = substr($seq, 0, -1);
$extended = 1;
print "\n$direction EXTENSION ROUND $trim_ct COMPLETE UNTIL $max_trim nt TRIMMED OFF => TRIMMED SEQUENCE:$seq\n\n" if ($verbose);
}
}### while trimming within bounds
#### Adjust the position if tracking paired reads in assembly
if($paired){
foreach my $rd (keys %$track){
$track->{$rd}{'start'} = length($seq) - $track->{$rd}{'start'} + 1;
$track->{$rd}{'end'} = length($seq) - $track->{$rd}{'end'} + 1;
}
}
print "\n*** NOTHING ELSE TO BE DONE IN $direction - PERHAPS YOU COULD DECREASE THE MINIMUM OVERLAP -m (currently set to -m $min_overlap) ***\n\n" if ($verbose);
return $seq, $set, $bin, $reads_needed, $total_bases, $track, $barcodeList;
}
#-----------------------
sub deleteData {
my ($bin,$set,$seed,$sequence,$e) = @_;
my @o = $sequence =~ /\S{4}/g;
my $comp_seq = reverseComplement($sequence);
my @c = $comp_seq =~ /\S{4}/g;
#remove k-mer from hash table and prefix tree
delete $bin->{$e->{$o[0]}}{$e->{$o[1]}}{$e->{$o[2]}}{$e->{$o[3]}}{$sequence};
delete $bin->{$e->{$c[0]}}{$e->{$c[1]}}{$e->{$c[2]}}{$e->{$c[3]}}{$comp_seq};
delete $set->{$sequence};
delete $seed->{$sequence};
return $bin, $set, $seed;
}
#-----------------------
sub reverseComplement{
$_ = shift;
$_ = uc();
tr/ATGC/TACG/;
return (reverse());
}
#-----------------
sub readFasta{
my ($matepair,$set,$bin,$file,$short,$paired,$encoded,$seedsplit,$space_restriction,$targetwordlen,$ignorehead,$sumall,$ctall) = @_;
my $ctrd = 0;
my $ctline = 0;
my $head = "";
my $insert_size = 0;
my $up_iz=0;
open(IN,$file) || die "Can't open $file -- fatal\n";
open (SHO, ">$short") || die "Can't write to $short -- fatal\n";
print "Sequence reads loaded:\n";
while(<IN>){
chomp;
$ctline++;
if(/^([^\>]*)$/i){
my $sdna = $1;
my $recruit_mate = 0; ### this will track whether a read matches a target (for targeted assembly of the full pair)
if($paired){
if($sdna =~/([ACGT]*)\:([ACGT]*)/i){### don't crash on Ns, but ignore see below
my ($rd1,$rd2) = ($1,$2);
my $head1 = $head . "1";
my $head2 = $head . "2";
####num
my $len = length($rd1) + length($rd2);
$sumall+=$len;
$ctall+=2;
$head1="" if($ignorehead);
$head2="" if($ignorehead);
($set,$bin,$ctrd,$recruit_mate) = &loadSequence($set,$bin,$ctrd,$rd1,$encoded,$head1,$up_iz,$seedsplit,$space_restriction,$targetwordlen,$recruit_mate);
($set,$bin,$ctrd,$recruit_mate) = &loadSequence($set,$bin,$ctrd,$rd2,$encoded,$head2,$up_iz,$seedsplit,$space_restriction,$targetwordlen,$recruit_mate);
($set,$bin,$ctrd,$recruit_mate) = &loadSequence($set,$bin,$ctrd,$rd1,$encoded,$head1,$up_iz,$seedsplit,$space_restriction,$targetwordlen,$recruit_mate) if($recruit_mate==1); ### re-visit the first read if second has match in target space
if($recruit_mate==2){
$matepair->{$rd1}{$rd2}{'is'} = $insert_size;
$matepair->{$rd2}{$rd1}{'is'} = $insert_size;
$matepair->{$rd1}{$rd2}{'bt'} = 0;
$matepair->{$rd2}{$rd1}{'bt'} = 0;
}
}else{
my $pairing_failure_message = "Input error at line #$ctline: The sequence \"$sdna\" is not in the right format for paired-end reads -- Fatal\nMake sure your input is in the form (input sequences can be of variable lengths):\n\n>test\nGCTACGACTATGACATACAGT:GTAGATTGATCGCATGCACGCT\n\nWhere : separates paired reads. Spaces, <<.>> or any characters other than A,C,G or T in your input file might have caused this error, including reads with Ns.\n";
print $pairing_failure_message;
print LOG $pairing_failure_message;
close LOG;
$assemblyruninfo.=$pairing_failure_message."\n";
exit;
}
}else{
$head="" if($ignorehead);
($set,$bin,$ctrd,$recruit_mate) = &loadSequence($set,$bin,$ctrd,$sdna,$encoded,$head,$up_iz,$seedsplit,$space_restriction,$targetwordlen,$recruit_mate) if ($sdna =~ /^([ACGT]*)$/i);
####num
my $len = length($sdna);
$sumall+=$len;
$ctall++;
}
}elsif(/^\>(\S+)/){
$head = $1;
if($paired){
($head,$insert_size) = ($1,$2) if($head=~/(\S+)\:(\d+)$/);
my $min_allowed = -1 * ($insert_stdev * $insert_size);
$up_iz = $insert_size - $min_allowed;
}
if($head eq "" || ($paired && $insert_size == 0)){
my $input_failure_message = "Input error at line #$ctline: $_ -- Either you forgot to name the mate pair template (head=$head), improperly formatted the insert size (iz=$insert_size) # or both. Headers should look like: >templateA:200\nIf you are not using the -p 1 option, you can leave \":insert_size\" out.\n";
print $input_failure_message;
print LOG $input_failure_message;
$assemblyruninfo.=$input_failure_message."\n";
close LOG;
exit;
}
}
}
close IN;
close SHO;
my $read_number_message = "\r$ctrd total sequences (" . keys( %$set ) . " unique)\n";
printf $read_number_message;
print LOG $read_number_message;
$assemblyruninfo.=$read_number_message . "\n";
return $set,$bin,$matepair,$sumall,$ctall;
}
#-----------------
### added 31Jan08 R.Warren
sub loadSeed{
my ($file,$targetwordlen) = @_;
my $seed;
my $seedsplit;
open(IN,$file) || die "Can't open $file -- fatal\n";
my ($subseq,$prev)=('','');
while(<IN>){
chomp;
if (/^\>(\S+)/){
my $head=$1;
my $subseq_length = length($subseq);
$MAX=$subseq_length if ($subseq_length > $MAX);
#print "$subseq...$subseq_length >= $MIN_READ_LENGTH && $subseq_length >= $min_overlap\n";
if($head ne $prev && $subseq ne '' && $subseq_length >= $MIN_READ_LENGTH && $subseq_length >= $min_overlap){
#print "$head <<< $prev\n";
my $ucsub = uc($subseq);
$seed->{$ucsub}{'count'}++;
$seed->{$ucsub}{'names'}{$prev}="";
$seed->{$ucsub}{'seed_name'}=$prev;
$seed->{$ucsub}{'ori'}=$subseq;
for(my $pos==0;$pos<= ($subseq_length-$targetwordlen);$pos++){
my $word=substr($ucsub,$pos,$targetwordlen);
my $word_rc = reverseComplement($word);
$seedsplit->{$word}=1;
$seedsplit->{$word_rc}=1;
}
if($subseq=~/([BDEFHIJKLMNOPQRSUVWXYZ])/i){print "WARNING: the fasta sequence >$prev in your seed file contains characters other than ACGT (i.e. $1) and may prevent proper contig extension.\n";}
}
$subseq='';
$prev=$head;
}elsif(/(\S+)/i){
$subseq .= $_;
}
}
my $subseq_length = length($subseq);
$MAX=$subseq_length if ($subseq_length > $MAX);
if($subseq ne '' && $subseq_length >= $MIN_READ_LENGTH && $subseq_length >= $min_overlap){
my $ucsub = uc($subseq);
$seed->{$ucsub}{'count'}++;
$seed->{$ucsub}{'names'}{$prev}="";
$seed->{$ucsub}{'seed_name'}=$prev;
$seed->{$ucsub}{'ori'}=$subseq;
for(my $pos==0;$pos<= ($subseq_length-$targetwordlen);$pos++){
my $word=substr($ucsub,$pos,$targetwordlen);
my $word_rc = reverseComplement($word);
$seedsplit->{$word}=1;
$seedsplit->{$word_rc}=1;
}
if($subseq=~/([BDEFHIJKLMNOPQRSUVWXYZ])/i){print "WARNING: the fasta sequence >$prev in your seed file contains characters other than ACGT (i.e. $1) and may prevent proper contig extension.\n";}
}
close IN;
return $seed,$seedsplit;
}
#-----------------
sub loadSequence{
my ($set,$bin,$ctrd,$seq,$e,$head,$up_iz,$seedsplit,$space_restriction,$targetwordlen,$recruit_mate) = @_;
my $orig=uc($seq);
my $orig_mer = length($orig);
if ($orig ne '' && $orig_mer >= $MIN_READ_LENGTH && $orig_mer >= $min_overlap){
if($space_restriction && $targetwordlen > $orig_mer){
my $msg = "ERROR LOADING READS: YOUR READ ($orig) IS SHORTER ($orig_mer nt) THEN -j ($targetwordlen) -- FATAL. REDUCE -j TO RESOLVE.\n";
print LOG $msg;
die $msg;
}
my @f = $orig =~ /\S{4}/g;
my $rc = reverseComplement($orig);
my @r = $rc =~ /\S{4}/g;
my $first_f = substr($orig,0,$targetwordlen);
my $first_r = substr($rc,0,$targetwordlen);
### added 31Jan08 R.Warren
$MAX=$orig_mer if ($orig_mer > $MAX);
if(! $space_restriction || ($space_restriction && (defined $seedsplit->{$first_f} || defined $seedsplit->{$first_r})) || $space_restriction && $recruit_mate){
$set->{$orig}{'count'}++;
$set->{$orig}{'names'}{$head}="";
$set->{$orig}{'grace'} = $up_iz;
my $barcode = "";
$barcode = $1 if($head =~ /\_(\w+)/); ### Jan 2018 THERE SHOULD ONLY BE ONE _ FOLLOWED BY BARCODE/INDEX/NUMBER
$bin->{$e->{$f[0]}}{$e->{$f[1]}}{$e->{$f[2]}}{$e->{$f[3]}}{$orig} = $barcode;### Jan 2018
$bin->{$e->{$r[0]}}{$e->{$r[1]}}{$e->{$r[2]}}{$e->{$r[3]}}{$rc} = $barcode;### Jan 2018
#was $bin->{$e->{$f[0]}}{$e->{$f[1]}}{$e->{$f[2]}}{$e->{$f[3]}}{$orig}++;
#was $bin->{$e->{$r[0]}}{$e->{$r[1]}}{$e->{$r[2]}}{$e->{$r[3]}}{$rc}++;
$recruit_mate++;
$ctrd++;
print "\r$ctrd";
$|++;
}
}elsif($orig ne ''){
if($orig_mer < $MIN_READ_LENGTH){
print SHO "$seq\tInput sequence shorter than minimum read length allowed ($orig_mer < $MIN_READ_LENGTH nt)\n";
}elsif($orig_mer < $min_overlap){
print SHO "$seq\tInput sequence shorter than minimum overlap specified($orig_mer < -m $min_overlap)\n";
}
}
$MAX = $MAX_TOP if ($MAX > $MAX_TOP);
return $set,$bin,$ctrd,$recruit_mate;
}
#-----------------
sub encodeBases{
my $encoded;
my @pos1= ('A','C','G','T');
my @pos2 = @pos1;
my @pos3 = @pos1;
my @pos4 = @pos1;
my @chararr = ("À","Á","Â","Ã","Ä","Å","Ā","Ą","Ă","Æ","Ç","Ć","Č","Ĉ","Ċ","Ď","Đ","È","É","Ê","Ë","Ē","Ę","Ě","Ĕ","Ė","Ĝ","Ğ","Ġ","Ģ","Ĥ","Ħ","Ì","Í","Î","Ï","Ī","Ĩ","Ĭ","Į","İ","IJ","Ĵ","Ķ","Ł","Ľ","Ĺ","Ļ","Ŀ","Ñ","Ń","Ň","Ņ","Ŋ","Ò","Ó","Ô","Õ","Ö","Ø","Ō","Ő","Ŏ","Œ","Ŕ","Ř","Ŗ","Ś","Š","Ş","Ŝ","Ș","Ť","Ţ","Ŧ","Ț","Ù","Ú","Û","Ü","Ū","Ů","Ű","Ŭ","Ũ","Ų","Ŵ","Ý","Ŷ","Ÿ","Ź","Ž","Ż","à","á","â","ã","ä","å","ā","ą","ă","æ","ç","ć","č","ĉ","ċ","ď","đ","è","é","ê","ë","ē","ę","ě","ĕ","ė","ƒ","ĝ","ğ","ġ","ģ","ĥ","ħ","ì","í","î","ï","ī","ĩ","ĭ","į","ı","ij","ĵ","ķ","ĸ","ł","ľ","ĺ","ļ","ŀ","ñ","ń","ň","ņ","ʼn","ŋ","ò","ó","ô","õ","ö","ø","ō","ő","ŏ","œ","ŕ","ř","ŗ","ś","š","ş","ŝ","ș","ť","ţ","ŧ","ț","ù","ú","û","ü","ū","ů","ű","ŭ","ũ","ų","ŵ","ý","ÿ","ŷ","ž","ż","ź","a","b","c","d","e","f","g","h","i","j","k","l","m","n","o","p","q","r","s","t","u","v","w","x","y","z","A","B","C","D","E","F","G","H","I","J","K","L","M","N","O","P","Q","R","S","T","U","V","W","X","Y","Z","1","2","3","4","5","6","7","8","9","0","α","β","χ","δ","ε");
#print "@chararr**\n";exit;
my $el=0;
foreach my $p1 (@pos1){
foreach my $p2 (@pos2){
foreach my $p3 (@pos3){
foreach my $p4 (@pos4){
my $quad = $p1.$p2.$p3.$p4;
$encoded->{$quad}=$chararr[$el];
#print "$quad .. $chararr[$el] .. $el :: $quad $encoded->{$quad}\n";
$el++;
}
}
}
}
return $encoded;
}
#-----------------
sub forcefillGaps{
my ($scaffold, $contig, $mergedtigs, $verbose, $min_tig_overlap, $max_count_trim, $npad_gaps, $alternate, $matepair, $min_overlap, $base_overlap, $min_base_ratio, $forcetrack, $max_trim, $encoded,$seedsplit,$space_restriction,$targetwordlen,$insert_stdev) = @_;
### STATIC
my $chunk = 300;
my $search_distance = 200;
open(IN,$scaffold) || die "can't read $scaffold -- fatal\n";
open(OUT,">$mergedtigs") || die "can't write to $mergedtigs -- fatal\n";
my ($tot,$sct,$ct_merge) = (0,0,0);
print "Loading read pairs to force-fill gaps...\n";
while(<IN>){### each line is a scaffold
chomp;
my $sc="";
my @a = split(/\,/);
my @tig;
if($a[2]=~/\_/){
@tig = split(/\_/,$a[2]);
}else{
push @tig, $a[2];
}
$sct++;
my ($ct,$mct) = (0,0);
my ($prev,$word,$template) = ("NA","NA","NA");
my ($seq,$prevseq,$headconcat,$prevEstimatedDistance) = ("","","","");
my ($prev_miniset,$prev_minibin)=({},{});
print "$_\n" if($verbose);
foreach my $t (@tig){### each contig
if($t=~/([fr])(\d+)z(\d+)(\S+)?/i){
my $orient = $1;
my $tnum=$2;
my $head = $orient . $tnum;
my $search = "tig" . $tnum;
my $tlen = $3;
my $other = $4;
$tot += $tlen;
my $estimatedDistance = "";
$estimatedDistance = $1 if($other=~/m((\-)?\d+)/);
print "\tSC $a[0] - TIG $ct. pattern: $t search: $search totalTigSize: $tot Orientation: $orient Gap/Overlap estimated distance: $estimatedDistance\n" if($verbose);
my $count_trim = 0;
open(FA,$contig) || die "Can't read $contig -- fatal\n";
READ:
while(<FA>){
chomp;
if (/\>(\S+)/){
my $head=$1;
$seq =~ s/[BDEFHIJKLMOPQRSUVWXYZ]/N/g;
if ($prev=~/$search\|/i && $prev ne $head && $prev ne "NA"){
last READ;
}
$prev = $head;
$seq='';
}elsif(/^(\S+)$/){
$seq.=uc($1);
}
}
close FA;
$seq = reverseComplement($seq) if($orient eq "f"); ###turn tig around for extension with previous reads
my $track;
my ($reads_needed,$total_bases,$tig_count)=(0,0,0);
my $barcodeList;
($seq, $prev_miniset, $prev_minibin, $reads_needed, $total_bases, $track, $barcodeList) = doExtension("GAP left", $MAX, $seq, $prev_miniset, $prev_minibin, $reads_needed, $total_bases, $min_overlap, $base_overlap, $min_base_ratio, $verbose, $track, $forcetrack, $tig_count, $max_trim, $encoded, $matepair,$tie_breaker,$ignore_read,$barcodeList) if($ct);###no need to extend first ($ct=0) contig on the left
($prev_miniset, $prev_minibin)=({},{});
$seq = reverseComplement($seq); ###re-change orientation for right extension (both fwd/rev tigs)
#-------------------FORCE-FILL GAPS (Controlled contig extension) BEFORE MERGING
#Inspect 2 contig edges for reads, collect partner and fill the gap with corresponding mates, while respecting the pairing logic:
#even if mates have been used before (likely repeats)
#existing(e) recruited(r)
# e--> <--r
# e--> <--r
# r--> <--e
# ===== ===== two contigs predicted to be linked
# recruited (r) can be assembled elsewhere (repeats), but NOT within $search_distance
my ($miniset,$minibin,$ctrd,$collect_candidates);
my $head = "NA";
my $next_tig = $ct+1;
if(defined $tig[$next_tig]){### a linking contig exists on the right
#collect reads from left contig
my $leftCoordList = $alternate->{$tnum};
if($orient eq "f"){ ### fwd contigs
my $instart = $tlen - $search_distance;
$instart = 0 if($instart<0);
my @window = ($instart .. $tlen); ### extend 5'->3' as-is
foreach my $coordstart(@window){
my $allrds = $leftCoordList->{$coordstart};
foreach my $partner (keys %$allrds){
if($coordstart < $allrds->{$partner}){ ### if start<end for a read means :: -->
my $partnerlist = $matepair->{$partner};###means mateseq should be <-- in the gap on the right
foreach my $mateseq(keys %$partnerlist){
print "* $partner partner mates with $mateseq on left fwd tig $tnum ($coordstart) [$instart-$tlen] . collecting $mateseq\n" if($verbose);
$collect_candidates->{$mateseq} = $partnerlist->{$mateseq};
}
}
}
}
}else{ ### rev contig
my @window = (0 .. $search_distance); ### right gap is on left of left reverse tig
foreach my $coordstart(@window){
my $allrds = $leftCoordList->{$coordstart};
foreach my $partner (keys %$allrds){
if($coordstart > $allrds->{$partner}){ ### reads are inversed:: <--
my $partnerlist = $matepair->{$partner};
foreach my $mateseq(keys %$partnerlist){
print "* $partner partner mates with $mateseq on left rev tig $tnum ($coordstart) [0-$search_distance]. collecting $mateseq\n" if($verbose);
$collect_candidates->{$mateseq} = $partnerlist->{$mateseq};
}
}
}
}
}
if($verbose){
my $numcollected = keys(%$collect_candidates);
print "$numcollected collected missing mates on gapleft\n";
}
#collect reads from right contig
my ($rr_orient,$rr_tnum,$rr_tlen)=($1,$2,$3) if($tig[$next_tig] =~/([fr])(\d+)z(\d+)(\S+)?/i);### contig to the right
my $rightCoordList = $alternate->{$rr_tnum};
if($rr_orient eq "r"){
my $instart = $rr_tlen - $search_distance; ### reverse contig on the right, must collect missing mates on the right
$instart = 0 if($instart<0);
my @window = ($instart .. $rr_tlen);
foreach my $coordstart(@window){
my $allrds = $rightCoordList->{$coordstart};
READ:
foreach my $partner (keys %$allrds){
if(defined $collect_candidates->{$partner}){### assembled read in right tig was collected from left tig as missing mate..,ust delete
print "! previously collected $partner candidate is already assembled on right tig #$rr_tnum ... will delete.\n" if($verbose);
delete $collect_candidates->{$partner};
next READ;
}
if($coordstart < $allrds->{$partner}){### read in this direction :: --->
my $partnerlist = $matepair->{$partner};
foreach my $mateseq(keys %$partnerlist){### implies missing mate in gap on the left (r tig makes it look left) is <---
$collect_candidates->{$mateseq} = $partnerlist->{$mateseq}{'is'};
print "* About to collect $mateseq mating with assembled $partner on right rev tig $rr_tnum ($coordstart) [$instart-$rr_tlen] tig=$ct next=$next_tig string=$tig[$next_tig] orient=$rr_orient len=$rr_tlen\n" if($verbose);
}
}
}
}
}else{###forward contig, gap is on the left
my @window = (0 .. $search_distance);
foreach my $coordstart(@window){
my $allrds = $rightCoordList->{$coordstart};
READ:
foreach my $partner (keys %$allrds){
if(defined $collect_candidates->{$partner}){
print "! previously collected $partner candidate is already assembled on right tig #$rr_tnum ... will delete.\n" if($verbose);
delete $collect_candidates->{$partner};
next READ;
}
if($coordstart > $allrds->{$partner}){# read <--- assembled
my $partnerlist = $matepair->{$partner};
foreach my $mateseq(keys %$partnerlist){#looking for ---> mate
$collect_candidates->{$mateseq} = $partnerlist->{$mateseq}{'is'};
print "* About to collect $mateseq mating with assembled $partner on right fwd tig $rr_tnum ($coordstart) [0-$search_distance] tig=$ct next=$next_tig string=$tig[$next_tig] orient=$rr_orient len=$rr_tlen\n" if($verbose);
}
}
}
}
}
if($verbose){
my $numcollected = keys(%$collect_candidates);
print "$numcollected collected revised after considering existing tig on right\n";
}
my $track;
my ($reads_needed,$total_bases,$tig_count)=(0,0,0);
foreach my $mateseq(keys %$collect_candidates){
my $recruit_mate = 0;
my $min_allowed = -1 * ($insert_stdev * $collect_candidates->{$mateseq});
my $up_iz = $collect_candidates->{$mateseq} - $min_allowed;
($miniset,$minibin,$ctrd,$recruit_mate) = &loadSequence($miniset,$minibin,$ctrd,$mateseq,$encoded,$head,$up_iz,$seedsplit,$space_restriction,$targetwordlen,$recruit_mate) if(length($mateseq) <= $illuminaLengthCutoff);
}
($seq, $miniset, $minibin, $reads_needed, $total_bases, $track, $barcodeList) = doExtension("GAP right", $MAX, $seq, $miniset, $minibin, $reads_needed, $total_bases, $min_overlap, $base_overlap, $min_base_ratio, $verbose, $track, $forcetrack, $tig_count, $max_trim, $encoded, $matepair,$tie_breaker,$ignore_read,$barcodeList);### extend first contig on the right
$prev_miniset = $miniset;###used reads have been deleted
$prev_minibin = $minibin;
($miniset,$minibin)=({},{});### flush custom prefix tree minibin and miniset
}### another contig in the scaffold is true (means a gap to fill)
print "\t$prev\n" if($verbose);
#### CONTIG MERGE CODE ####
if($word ne "NA"){
#####
if(length($seq)<=$chunk){
$template = $seq;
}else{
$template = substr($seq,0,$chunk);
}
##### word search
my $dynamic_word = $word;
SCAN:
until($template =~ /$dynamic_word/){
$dynamic_word = substr($dynamic_word,1,length($dynamic_word));###5' del 1bp at a time
if(length($dynamic_word) < $min_tig_overlap){
$count_trim++;
last SCAN if($count_trim >= $max_count_trim);
$dynamic_word = substr($word,0,length($word)-$count_trim); ###when overlap too short,reset then 3'del
}
}
if($seq =~ /^\S{0,$max_count_trim}$dynamic_word(.*)/){### will grab the left-most match which is ok
my $tail = $1;
my $all = "ERROR_";
while($prevseq =~ /^(.*)$dynamic_word/ig){
$all = $1;
}
print "$prevseq **** $all **** WORD:$word *** DWord:$dynamic_word *** COUNTTRIM:$count_trim\n" if ($verbose && $all=~/ERROR/);
$prevseq = $all . lc($dynamic_word) . $tail;
my $overlap = length($dynamic_word);
$ct_merge++;
print "$ct_merge. GROUNDS FOR MERGING ($overlap nt overlap) !!!\n" if($verbose);
$headconcat .= "+" . $prev;
}else{### no overlaps
if(! $npad_gaps){### do not put Ns in gaps
print "No MERGE, will print previous sequence and memorize current.\n" if($verbose);
my $scsz = length($prevseq);
print OUT ">$a[0].$mct|size$scsz $headconcat\n$prevseq\n";
$prevseq = $seq;
$headconcat = $prev;
$mct++;
}else{ ### place Ns in gaps, n for predicted but undetected overlaps
### ADDED RLW 5.MAR.2010
if($prevEstimatedDistance <= 0){
$prevseq .= "n" . $seq
}else{
$prevseq .= ("N" x $prevEstimatedDistance) . $seq;
}
$headconcat .= "+" . $prev;
}
}
}else{
$prevseq = $seq;
$headconcat = $prev;
$mct++;
}
##### For the next search
if(length($seq)<=$chunk){
$word = $seq;
}else{
$word = substr($seq,length($seq)-$chunk,$chunk); ### this will be the next word to search with
}
###########################
$prevEstimatedDistance = $estimatedDistance;
}#tig regex
$ct++;
}#each tig
my $scsz = length($prevseq);
print OUT ">$a[0].$mct|size$scsz $headconcat\n$prevseq\n";
$prevseq = '';
}
close IN;
close OUT;
}
#-------------------
sub readContigsMemory{
my $file = shift;
my $tig_length;
my $tignames;
my $fh;
my $prevhead="";
my $seq="";
my $cttig=0;
###Support for compressed files MAR2016
if($file=~/zip$/i){
open(IN,"unzip -p $file|") || die "Error reading $file -- fatal\n";
}elsif($file=~/gz$/i || $file=~/gzip$/i){
open(IN,"gunzip -c $file|") || die "Error reading $file -- fatal\n";
}else{
open(IN,$file) || die "Error reading $file -- fatal\n";
}
while(<IN>){
chomp;
if(/^\>(.*)/){
my $head=$1;
if ($head ne $prevhead && $seq ne '' && $prevhead ne ''){
$cttig++;
$tignames->{$cttig} = $prevhead;
$fh->{$cttig} = $seq;
$tig_length->{$cttig} = length($seq);
}
$seq = '';
$prevhead = $head;
}else{
$seq .= uc($_);
}
}
$cttig++;
$tignames->{$cttig} = $prevhead;
$fh->{$cttig} = $seq;
$tig_length->{$cttig} = length($seq);
return $fh,$tignames,$tig_length;
}
#-------------------
sub buildScaffoldFasta{
my ($dotscaffold,$fh,$scaffold_fasta) = @_;
open(IN,$dotscaffold) || die "Cannot open $dotscaffold for reading -- fatal.\n";
open(OUT,">$scaffold_fasta") || die "can't write to $scaffold_fasta -- fatal\n";
my $tot=0;
my $ct=0;
my $sct=0;
while(<IN>){### each line
chomp;
my $sc="";
my @a = split(/\,/);
my @tig;
if($a[2]=~/\_/){
@tig = split(/\_/,$a[2]);
}else{
push @tig, $a[2];
}
$sct++;
my $tigsum=0;
print OUT ">$_\n";
foreach my $t (@tig){
$ct++;
if($t=~/([fr])(\d+)z(\d+)(\S+)?/i){
my $orient = $1;
my $tnum=$2;
my $head = $orient . $tnum;
my $search = $tnum;
my $other = $4;
$tot+= $3;
$tigsum +=$3;
my $gap = "NA";
my $numlinks = "NA";
my $linksratio = "NA";
my $gapseq = "";
$numlinks = $1 if($other=~/k(\d+)/);
$linksratio = $1 if($other=~/a(\d+.*)m/);
$gap = $1 if($other=~/m(\-?\d+)/);
my $seq = $fh->{$search};
$seq = reverseComplement($seq) if($orient eq "r");
$gapseq = "N" x $gap if($gap > 0);
$gapseq = "n" if($gap ne "NA" && $gap <= 0 );
$seq .= $gapseq;
print OUT "$seq";
}#tig regex
}#each tig
print OUT "\n";
}
close CORROUT;
close IN;
close OUT;
}
## We hope this code is useful to you -- Please send comments & suggestions to rwarren at bcgsc.ca
|