/usr/share/EMBOSS/test/data/primers is in emboss-test 6.4.0-2.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 | # This is my primer file
D1S243 cacacaggctcacatgcc gctccagcgtcatggact
D1S468 aattaaccgttttggtcct gcgacacacacttccc
D1S2845 ccaaagggtgcttctc gtggcattccaacctc
D1S1608 gatggcttttggggactatt cactgagccaagtgacacag
D1S2893 aaaacatcaactctcccctg ctcaaaccccaataagcctt
D1S2660 cacacatgcacatgcac agtgacaccagcaggg
|