/var/lib/mobyle/programs/seq-gen.xml is in mobyle-programs 5.1.2-1.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 | <?xml version='1.0' encoding='UTF-8'?>
<!-- XML Authors: Corinne Maufrais, Nicolas Joly and Bertrand Neron, -->
<!-- 'Biological Software and Databases' Group, Institut Pasteur, Paris. -->
<!-- Distributed under LGPLv2 License. Please refer to the COPYING.LIB document. -->
<program>
<head>
<name>seq-gen</name>
<version>1.3.2</version>
<doc>
<title>SeqGen</title>
<description>
<text lang="en">Sequence-Generator</text>
</description>
<authors>A. Rambaut, N. C. Grassly</authors>
<reference>Rambaut, A. and Grassly, N. C. (1996) Seq-Gen: An application for the Monte Carlo simulation of DNA sequence evolution along phylogenetic trees. Comput. Appl. Biosci.</reference>
<doclink>http://bioweb2.pasteur.fr/docs/seq-gen/index.html</doclink>
<comment>
<text lang="en">Seq-Gen is a program that will simulate the evolution of nucleotide or amino acid sequences along a phylogeny, using common models of the substitution process.</text>
</comment>
<homepagelink>http://tree.bio.ed.ac.uk/software/seqgen/</homepagelink>
<sourcelink>http://tree.bio.ed.ac.uk/download.html?name=seqgen&version=v1.3.2&id=41&num=1</sourcelink>
</doc>
<category>phylogeny:likelihood</category>
</head>
<parameters>
<parameter iscommand="1" ishidden="1">
<name>seqgen</name>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<format>
<code proglang="perl">"seq-gen"</code>
<code proglang="python">"seq-gen"</code>
</format>
<argpos>0</argpos>
</parameter>
<parameter ismandatory="1" issimple="1">
<name>intree</name>
<prompt lang="en">Input tree file</prompt>
<type>
<datatype>
<class>Tree</class>
</datatype>
<dataFormat>NEWICK</dataFormat>
<dataFormat>NEXUS</dataFormat>
</type>
<format>
<code proglang="perl">"< $value"</code>
<code proglang="python">"< " + str(value)</code>
</format>
<argpos>0</argpos>
</parameter>
<paragraph>
<name>input</name>
<prompt lang="en">Input parameters</prompt>
<argpos>1</argpos>
<parameters>
<parameter>
<name>Length</name>
<prompt lang="en">Sequence length (-l)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<vdef>
<value>1000</value>
</vdef>
<format>
<code proglang="perl">(defined $value and $value != $vdef)? " -l $value":""</code>
<code proglang="python">("" , " -l " + str(value))[ value is not None and value != vdef]</code>
</format>
<comment>
<text lang="en">This option allows the user to set the length in nucleotides that each simulated sequence should be.</text>
</comment>
</parameter>
<parameter>
<name>datasets</name>
<prompt lang="en">Number of simulated datasets per tree (-n)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<vdef>
<value>1</value>
</vdef>
<format>
<code proglang="perl">(defined $value and $value != $vdef)? " -n $value":""</code>
<code proglang="python">("" , " -n " + str(value))[ value is not None and value != vdef]</code>
</format>
<comment>
<text lang="en">This option specifies how many separate datasets should be simulated for each tree in the tree file.</text>
</comment>
</parameter>
<parameter>
<name>partition_numb</name>
<prompt lang="en">Number of partitions for each dataset (-p)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<vdef>
<value>1</value>
</vdef>
<format>
<code proglang="perl">(defined $value and $value != $vdef)? " -p $value":""</code>
<code proglang="python">("" , " -p " + str(value))[ value is not None and value != vdef]</code>
</format>
<comment>
<text lang="en">Number of partion specifies how many partitions of each data set should be simulated. each partition must have its own tree and number specifying how many sites are in partition. Multiple sets of trees are being inputed with varying numbers of partitions, then this should specify the maximum number of partitions that will be required</text>
</comment>
</parameter>
<parameter>
<name>scale_branch</name>
<prompt lang="en">Scale branch lengths (number greater > 0) (-s)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="perl">not defined $scale_tree</code>
<code proglang="python">scale_tree is None</code>
</precond>
<vdef>
<value>1.0</value>
</vdef>
<format>
<code proglang="perl">(defined $value and $value != $vdef)? " -s $value":""</code>
<code proglang="python">("" , " -s " + str(value))[ value is not None and value != vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than 0 is required</text>
</message>
<code proglang="perl">$value > 0</code>
<code proglang="python">value > 0</code>
</ctrl>
<comment>
<text lang="en">This option allows the user to set a value with which to scale the branch lengths in order to make them equal the expected number of substitutions per site for each branch. Basically Seq-Gen multiplies each branch length by this value.</text>
<text lang="en">For example if you give an value of 0.5 then each branch length would be halved before using it to simulate the sequences.</text>
</comment>
</parameter>
<parameter>
<name>scale_tree</name>
<prompt lang="en">Total tree scale (a decimal number greater > 0) (-d)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="perl">$scale_branch != 1.0</code>
<code proglang="python">scale_branch != 1.0 </code>
</precond>
<format>
<code proglang="perl">(defined $value)? " -d $value":""</code>
<code proglang="python">("" , " -d " + str(value))[ value is not None ]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than 0 is required</text>
</message>
<code proglang="perl">$value > 0</code>
<code proglang="python">value > 0</code>
</ctrl>
<comment>
<text lang="en">This option allows the user to set a value which is the desired length of each tree in units of substitutions per site. The term 'tree length' here is the distance from the root to any one of the tips in units of mean number of substitutions per site. This option can only be used when the input trees are rooted and ultrametric (no difference in rate amongst the lineages). This has the effect of making all the trees in the input file of the same length before simulating data.</text>
<text lang="en"> The option multiplies each branch length by a value equal to SCALE divided by the actual length of the tree.</text>
</comment>
</parameter>
<parameter>
<name>input_seq</name>
<prompt lang="en">Ancestral Sequence number (-k)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<format>
<code proglang="perl">(defined $value)? " -k $value":""</code>
<code proglang="python">("" , " -k " + str(value))[ value is not None ]</code>
</format>
<comment>
<text lang="en">This option allows the user to use a supplied sequence as the ancestral sequence at the root (otherwise a random sequence is used). The value is an integer number greater than zero which refers to one of the sequences supplied as input with the tree.</text>
<text lang="en">Method: The user can supply a sequence alignment as input, as well as the trees. This should be in relaxed PHYLIP format. The trees can then be placed in this file at the end, after a line stating how many trees there are. The file may look like this: </text>
<text lang="en">4 50</text>
<text lang="en">Taxon1 ATCTTTGTAGTCATCGCCGTATTAGCATTCTTAGATCTAA</text>
<text lang="en">Taxon2 ATCCTAGTAGTCGCTTGCGCACTAGCCTTCCGAAATCTAG</text>
<text lang="en">Taxon3 ACTTCTGTGTTTACTGAGCTACTAGCTTCCCTAAATCTAG</text>
<text lang="en">Taxon4 ATTCCTATATTCGCTAATTTCTTAGCTTTCCTGAATCTGG</text>
<text lang="en">1</text>
<text lang="en">(((Taxon1:0.2,Taxon2:0.2):0.1,Taxon3:0.3):0.1,Taxon4:0.4);</text>
<text lang="en">Note that the labels in the alignment do not have to match those in the tree (the ones in the tree will be used for output) there doesn't even have to be the same number of taxa in the alignment as in the trees. The sequence length supplied by the alignment will be used to obtain the simulated sequence length (unless the l option is set). The k option also refers to one of the sequences to specify the ancestral sequence. (see Appendix A)</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>substitution</name>
<prompt lang="en">Substitution model options</prompt>
<argpos>1</argpos>
<parameters>
<parameter>
<name>model</name>
<prompt lang="en">Model of substitution (-m)</prompt>
<type>
<datatype>
<class>Choice</class>
</datatype>
</type>
<vdef>
<value>JTT</value>
</vdef>
<vlist>
<velem>
<value>JTT</value>
<label>JTT</label>
</velem>
<velem>
<value>WAG</value>
<label>WAG</label>
</velem>
<velem>
<value>PAM</value>
<label>PAM</label>
</velem>
<velem>
<value>BLOSUM</value>
<label>BLOSUM</label>
</velem>
<velem>
<value>MTREV</value>
<label>MTREV</label>
</velem>
<velem>
<value>GENERAL</value>
<label>GENERAL</label>
</velem>
<velem>
<value>F84</value>
<label>F84 (nucleic)</label>
</velem>
<velem>
<value>HKY</value>
<label>HKY (nucleic)</label>
</velem>
<velem>
<value>GTR</value>
<label>GTR (nucleic)</label>
</velem>
</vlist>
<format>
<code proglang="perl">(defined $value )? " -m $value" : "" </code>
<code proglang="python">( "" , " -m " + str(value) )[ value is not None ]</code>
</format>
</parameter>
<parameter>
<name>shape</name>
<prompt lang="en">Shape of the gamma distribution to use with gamma rate heterogeneity (-a)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<format>
<code proglang="perl">(defined $value)? " -a $value":""</code>
<code proglang="python">("" , " -a " + str(value))[ value is not None ]</code>
</format>
<argpos>1</argpos>
<comment>
<text lang="en">Using this option the user may specify a shape for the gamma rate heterogeneity. The default is no site-specific rate heterogeneity. Enter a decimal number.</text>
</comment>
</parameter>
<parameter>
<name>categories</name>
<prompt lang="en">Number of categories for the discrete gamma rate heterogeneity model (-g)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<format>
<code proglang="perl">(defined $value)? " -g $value":""</code>
<code proglang="python">("" , " -g " + str(value))[ value is not None ]</code>
</format>
<ctrl>
<message>
<text lang="en">Enter an integer number between 2 and 32</text>
</message>
<code proglang="perl">$value >= 2 and $value <= 32</code>
<code proglang="python">value >= 2 and value <= 32 </code>
</ctrl>
<argpos>1</argpos>
<comment>
<text lang="en">Using this option the user may specify the number of categories for the discrete gamma rate heterogeneity model. The default is no site-specific rate heterogeneity (or the continuous model if only the -a option is specified. Enter an integer number between 2 and 32</text>
</comment>
</parameter>
<parameter>
<name>invar_site</name>
<prompt lang="en">Proportion of sites that should be invariable (-i)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<vdef>
<value>0.0</value>
</vdef>
<format>
<code proglang="perl">(defined $value and $value != $vdef)? " -i $value":""</code>
<code proglang="python">("" , " -i " + str(value))[ value is not None and value != vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Enter a real number between 0.0 and 1.0 </text>
</message>
<code proglang="perl">$value >= 0.0 and $value <= 1.0</code>
<code proglang="python">value >= 0.0 and value <= 1.0</code>
</ctrl>
<argpos>1</argpos>
<comment>
<text lang="en">Specify the proportion of sites that should be invariable. These sites will be chosen randomly with this expected frequency. The default is no invariable sites. Invariable sites are sites thar cannot change as opposed to sites which don't exhibit any changes due to chance (and perhaps a low rate). Enter a real number between 0.0 and 1.0</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>nucleotide_opt</name>
<prompt lang="en">Nucleotid model specific options</prompt>
<argpos>1</argpos>
<parameters>
<paragraph>
<name>rate</name>
<prompt lang="en">Rates for codon position heterogeneity (-c)</prompt>
<comment>
<text lang="en">Using this option the user may specify the relative rates for each codon position. This allows codon-specific rate heterogeneity to be simulated. The default is no site-specific rate heterogeneity.</text>
<text lang="en">You can only have codon rates when using nucleotide models of substitution.</text>
</comment>
<parameters>
<parameter>
<name>rate1</name>
<prompt lang="en">First position</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<format>
<code proglang="perl">""</code>
<code proglang="python">""</code>
</format>
<comment>
<text lang="en">Enter a decimal number</text>
<text lang="en">You can only have codon rates when using nucleotide models of substitution.</text>
</comment>
</parameter>
<parameter>
<name>rate2</name>
<prompt lang="en">Second position </prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<format>
<code proglang="perl">""</code>
<code proglang="python">""</code>
</format>
<comment>
<text lang="en">Enter a decimal number</text>
</comment>
</parameter>
<parameter>
<name>rate3</name>
<prompt lang="en">Third position (enter a decimal number)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<format>
<code proglang="perl">""</code>
<code proglang="python">""</code>
</format>
<comment>
<text lang="en">Enter a decimal number</text>
</comment>
</parameter>
<parameter ishidden="1">
<name>rateAll</name>
<prompt lang="en">Rates</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="perl">defined $rate1 and defined $rate2 and defined $rate3</code>
<code proglang="python">rate1 is not None and rate2 is not None and rate3 is not None</code>
</precond>
<format>
<code proglang="perl">" -c $rate1 $rate2 $rate3"</code>
<code proglang="python">" -c %f %f %f " %(rate1,rate2,rate3)</code>
</format>
</parameter>
</parameters>
</paragraph>
<parameter>
<name>transratio</name>
<prompt lang="en">Transition transversion ratio (TS/TV) for HKY or F84 model (-t)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="perl">$model eq 'HKY' or $model eq 'F84'</code>
<code proglang="python">model =='HKY' or model == 'F84'</code>
</precond>
<format>
<code proglang="perl">(defined $value)? " -t $value":""</code>
<code proglang="python">("" , " -t " + str(value))[ value is not None ]</code>
</format>
<comment>
<text lang="en">This option allows the user to set a value for the transition transversion ratio (TS/TV). This is only valid when either the HKY or F84 model has been selected.</text>
</comment>
</parameter>
<parameter>
<name>matrix</name>
<prompt lang="en">6 values for the general reversable model's rate matrix (ACTG x ACTG) separated by one space (-r)</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<vdef>
<value>1.0,1.0,1.0,1.0,1.0,1.0</value>
</vdef>
<format>
<code proglang="perl">(defined $value and $value ne $vdef)? " -r $value":""</code>
<code proglang="python">("" , " -r " + str(value))[ value is not None and value != vdef]</code>
</format>
<argpos>1</argpos>
<comment>
<text lang="en">This option allows the user to set 6 values for the general reversable model's rate matrix. This is only valid when either the REV model has been selected.</text>
<text lang="en">The values are six decimal numbers for the rates of transition from A to C, A to G, A to T, C to G, C to T and G to T respectively, separated by spaces or commas. The matrix is symmetrical so the reverse transitions equal the ones set (e.g. C to A equals A to C) and therefore only six values need be set. These values will be scaled such that the last value (G to T) is 1.0 and the others are set relative to this.</text>
</comment>
</parameter>
<paragraph>
<name>frequencies</name>
<prompt lang="en">Relative frequencies of nucleotides (-f)</prompt>
<argpos>1</argpos>
<comment>
<text lang="en">This option is used to specify the relative frequencies of the four nucleotides. By default, Seq-Gen will assume these to be equal. If the given values don't sum to 1.0 then they will be scaled so that they do.</text>
<text lang="en">You must give the frequencies for the 4 nucleotides</text>
</comment>
<parameters>
<parameter>
<name>freqA</name>
<prompt lang="en">Frequencies of the A nucleotide</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<format>
<code proglang="perl">""</code>
<code proglang="python">""</code>
</format>
</parameter>
<parameter>
<name>freqC</name>
<prompt lang="en">Frequencies of the C nucleotide </prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<format>
<code proglang="perl">""</code>
<code proglang="python">""</code>
</format>
</parameter>
<parameter>
<name>freqG</name>
<prompt lang="en">Frequencies of the G nucleotide</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<format>
<code proglang="perl">""</code>
<code proglang="python">""</code>
</format>
</parameter>
<parameter>
<name>freqT</name>
<prompt lang="en">Frequencies of the T nucleotide</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<format>
<code proglang="perl">""</code>
<code proglang="python">""</code>
</format>
</parameter>
<parameter ishidden="1">
<name>freqAll</name>
<prompt lang="en">Frequencies</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<precond>
<code proglang="perl">defined $freqA and defined $freqC and defined $freqG and defined $freqT</code>
<code proglang="python">freqA is not None and freqC is not None and freqG is not None and freqT is not None</code>
</precond>
<format>
<code proglang="perl">" -f $freqA,$freqC,$freqG,$freqT"</code>
<code proglang="python">" -f " + str(freqA) + "," + str(freqC) + "," + str(freqG) + "," + str(freqT)</code>
</format>
</parameter>
</parameters>
</paragraph>
</parameters>
</paragraph>
<paragraph>
<name>miscellaneous_opt</name>
<prompt lang="en">Miscellaneous options</prompt>
<argpos>1</argpos>
<parameters>
<parameter>
<name>random_seed</name>
<prompt lang="en">Random number seed (-z)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<format>
<code proglang="perl">(defined $value)? "-z $value":""</code>
<code proglang="python">("" , "-z " + str(value))[ value is not None ]</code>
</format>
<comment>
<text lang="en">This option allows to specify a seed for the random number generator. Using the same seed (with the same input) will result in identical simulated datasets. This is useful because you can recreate a set of simulations, you must use exactly the same model options</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>output</name>
<prompt lang="en">Output parameters</prompt>
<argpos>1</argpos>
<parameters>
<parameter>
<name>output_format</name>
<prompt lang="en">Output file format (-o)</prompt>
<type>
<datatype>
<class>Choice</class>
</datatype>
</type>
<vdef>
<value>p</value>
</vdef>
<vlist>
<velem>
<value>p</value>
<label>PHYLIP (p)</label>
</velem>
<velem>
<value>r</value>
<label>Relaxed PHYLIP (r)</label>
</velem>
<velem>
<value>n</value>
<label>NEXUS (n)</label>
</velem>
</vlist>
<format>
<code proglang="perl">(defined $value and $value ne $vdef)? " -o$value":""</code>
<code proglang="python">("" , " -o" + str(value))[ value is not None and value != vdef]</code>
</format>
</parameter>
<parameter>
<name>quiet</name>
<prompt lang="en">Non verbose output (-q)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -q":""</code>
<code proglang="python">("" , " -q")[ value ]</code>
</format>
<argpos>1</argpos>
</parameter>
<parameter>
<name>write_ancest</name>
<prompt lang="en">Write the ancestral sequences (-wa)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -wa":""</code>
<code proglang="python">("" , " -wa")[ value ]</code>
</format>
<comment>
<text lang="en">This option allows to obtain the sequences for each of the internal nodes in the tree. The sequences are written out along with the sequences for the tips of the tree in relaxed PHYLIP format.</text>
</comment>
</parameter>
<parameter>
<name>write_sites</name>
<prompt lang="en">Write the sites rates (-wr)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -wr":""</code>
<code proglang="python">("" , " -wr")[ value ]</code>
</format>
<comment>
<text lang="en">This option allows to obtain the relative
rate of substitution for each sites as used in each
simulation. This will go to stderr and will be produced
for each replicate simulation.</text>
</comment>
</parameter>
<parameter isstdout="1">
<name>outfile</name>
<prompt lang="en">Output alignment file</prompt>
<type>
<datatype>
<class>Alignment</class>
</datatype>
<dataFormat>
<test param="output_format" eq="p">PHYLIPI</test>
<test param="output_format" eq="r">RPHYLIP</test>
<test param="output_format" eq="n">NEXUS</test>
</dataFormat>
</type>
<filenames>
<code proglang="perl">"seqgen.out"</code>
<code proglang="python">"seqgen.out"</code>
</filenames>
</parameter>
</parameters>
</paragraph>
</parameters>
</program>
|