/usr/bin/tqs is in ssake 3.8.2-1.
This file is owned by root:root, with mode 0o755.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 | #!/usr/bin/env python
__doc__ = """
TQS
Trim Quality Solexa Sequences (TQS)
SYNOPSIS
Quality trim solexa-Illumina sequence reads using user-defined thresholds
"""
__author__ = "Rene L. Warren"
__version__ = '1.0'
#LICENSE
# Copyright (c) 2007 Canada's Michael Smith Genome Science Centre. All rights reserved.
# This program is free software; you can redistribute it and/or
# modify it under the terms of the GNU General Public License
# as published by the Free Software Foundation; either version 2
# of the License, or (at your option) any later version.
# This program is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU General Public License for more details.
import sys, os, re, string
from datetime import datetime
from optparse import OptionParser
def main():
usage = "Usage: %s --help"
parser = OptionParser()
parser.add_option("-f", "--sequence file", dest="seqfile",
help="Illumina sequence file - Output format from the 1G Genome Analyzer (_seq.txt): 7 1 255 669 AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC",)
parser.add_option("-q", "--qual file", dest="qualfile",
help="A prb file containing all the Illumina intensities, as outputted by the 1G Genome Analyzer (_prb.txt)",)
parser.add_option("-l", "--length", dest="mer", type="int", default=36,
help="Length of sequence reads (i.e. Number of sequencing cycles, default=36)",)
parser.add_option("-t", "--threshold", dest="threshold", type="int", default=5,
help="Base intensity threshold value (-40 to 40, default=5)",)
parser.add_option("-d", "--difference", dest="diff", type="int", default=5,
help="Base intensity difference between top intensity and second best (1 to 80, default=5)",)
parser.add_option("-c", "--consec", dest="consec", type="int", default=20,
help="Minimum number of consecutive bases passing threshold values (default=20)",)
parser.add_option("-v", "--verbose", dest="verbose", action="store_true",
help="Runs in Verbose mode.",)
(opts, args) = parser.parse_args()
try:
f = open(opts.seqfile)
seq = f.readlines()
f.close()
except Exception, e:
print "ERROR: Could not read from %s: %s" % (opts.seqfile, e)
print usage % (sys.argv[0:])
sys.exit()
try:
f = open(opts.qualfile)
qual = f.readlines()
f.close()
except Exception, e:
print "ERROR: Could not read from %s: %s" % (opts.qualfile, e)
print usage % (sys.argv[0:])
sys.exit()
fasta = "%s_I%sD%sL%s.trim.fa" % (opts.seqfile,opts.threshold,opts.diff,opts.consec)
log = "%s.log" % opts.seqfile
try:
FASTA = open(fasta, 'w')
except:
print "ERROR: Can not write to %s" % fasta
sys.exit()
try:
LOG = open(log, 'w')
except:
print "ERROR: Can not write to %s" % log
sys.exit()
if opts.mer < 15 or opts.mer > 200:
print "ERROR: -l must be a number between 15 and 200."
sys.exit()
if opts.consec < 16 or opts.consec > opts.mer:
print "ERROR: -c must be a number between 16 and -l."
sys.exit()
LOG.write("""
Running:
%s
-f %s
-q %s
-l %s
-c %s
-t %s
-d %s
Fasta file: %s
""" % (sys.argv[0:],opts.seqfile, opts.qualfile, opts.mer, opts.consec, opts.threshold, opts.diff, fasta))
t0 = datetime.now()
LOG.write("\nReading Quality File: %s\n" % str(t0)[:len('2006-10-05 23:04')])
trim_info = parseQualFile(opts.threshold, opts.diff, opts.consec, opts.mer, qual, opts.verbose, LOG)
t1 = datetime.now()
LOG.write("\n\nTrimming low quality bases: %s\n" % str(t1)[:len('2006-10-05 23:04')])
readNTrim(trim_info, seq, opts.verbose, FASTA, LOG)
LOG.write("DNA sequences have been trimmed accordingly and placed in %s" % fasta)
LOG.close()
FASTA.close()
return
#--------------------------------------------------------------------------------------
def parseQualFile(threshold, difference, consecutive, read_length, qual, verbose, LOG):
"""
Parse a solexa-illumina intensity file
Return a Dictionary of sequence order number, with the index value and length to extract
"""
trim_info = {}
ok_read = 0
read_number = 0
if verbose:
print "Printing trimming pattern for all reads passing the set threshold values...\n"
for line in qual:
read_number += 1 ### this keeps track of the read order, respected between the prb and seq files
concat = "" ### concat builds a string of bases passing the user-defined filter
quartets = line.split("\t") ### split quartet (4 number per position)
for quartet in quartets: ### cycle through each quartet
quad = (quartet.split())
quadint = []
for basequal in quad: ### each intensity/number for each position
quadint.append(int(basequal))
quadint.sort()
quadint.reverse()
basediff = quadint[0] - quadint[1]
#print "T=%i D=%i" % (quadint[0],basediff)
if quadint[0] < threshold or basediff < difference:
concat += "x"
else:
concat += "-"
head_match_regex = re.compile("\-{%i,%i}" % (consecutive,read_length))
head_match = head_match_regex.search(concat)
if head_match != None:
ok_read += 1
col = head_match.span()
if not trim_info.has_key(read_number):
trim_info[read_number] = {}
start = int(col[0])
end = int(col[1])
trim_info[read_number]['start'] = start
trim_info[read_number]['end'] = end
if verbose:
sub = concat[trim_info[read_number]['start']:trim_info[read_number]['end']]
print "passed seqs:%i line#%i %s (start trim:%i,length:%i) %s\n" % (ok_read, read_number, concat, start, end, sub)
LOG.write("%i out of %i sequences passed your filter (I >= %i and D >= %i and L >= %i)\n" % (ok_read, read_number, threshold, difference, consecutive))
return trim_info
#--------------------------------------------------------------------------------------
def readNTrim(trim_info, seq, verbose, FASTA, LOG):
"""
Parse a solexa/illumina sequence file and trim DNA sequence based user-defined intensity threshold/differences
"""
read_number = 0
gDNAlinker_count = 0
usable_reads = 0
dna_sequence_field = re.compile('^[ACTG]+$')
gDNAlinker1_field = re.compile('^ATCCCC[GA]A')
gDNAlinker2_field = re.compile('^ATCTAACAG')
if verbose:
print "Printing trimmed sequences for all reads passing the set threshold values minus, excluding sequence containing linkers...\n"
for line in seq:
read_number += 1 ### tracks read number / will match order in prb file
line = line.rstrip('\r\n')
info = line.split("\t") ### split line, the seq file lists: lane tile xcoord y coord DNAseq
dna_string = info[4]
if trim_info.has_key(read_number):
trim_seq = dna_string[trim_info[read_number]['start']:trim_info[read_number]['end']]
if re.match(dna_sequence_field, trim_seq): ### no ambiguous bases?
if re.match(gDNAlinker1_field, trim_seq) or re.match(gDNAlinker2_field,trim_seq): ### matches gDNA linker?
gDNAlinker_count += 1
else:
usable_reads += 1
FASTA.write(">%s-%s-%s-%s\n%s\n" % (info[0],info[1],info[2],info[3],trim_seq))
if verbose:
print "line#%i %s (start trim:%i,length:%i) %s" % (read_number,info[4],trim_info[read_number]['start'],trim_info[read_number]['end'],trim_seq)
LOG.write("%i out of %i sequences appear to be usable, after filtering out sequences hard-coded in this program * %i gDNA linker sequences*\n" % (usable_reads, read_number,gDNAlinker_count))
return
if __name__ == '__main__':
main()
import time
sys.exit()
|